Aquatic Invasions (2022) Volume 17, Issue 3: 415–430 CORRECTED PROOF Research Article Population structure and demography of non-indigenous Japanese mystery snails in freshwater habitats of Virginia and Washington, D.C., USA Amy E. Fowler1,*, Grace A. Loonam1 and April M.H. Blakeslee2 1Department of Environmental Science and Policy, George Mason University, Fairfax, VA, 22030, USA 2Biology Department, East Carolina University, Greenville, NC, 27858, USA *Corresponding author E-mail: afowler6@gmu.edu Citation: Fowler AE, Loonam GA, Blakeslee AMH (2022) Population Abstract structure and demography of non- indigenous Japanese mystery snails in Non-indigenous species may drive declines in global freshwater biodiversity. Japanese freshwater habitats of Virginia and mystery snails, Heterogen japonica (previously Cipangopaludina / Bellamya / Viviparus Washington, D.C., USA. Aquatic Invasions japonica), have invaded numerous freshwater systems in North America. To resolve 17(3): 415–430, https://doi.org/10.3391/ai. questions about its population demography and genetics, we surveyed ponds and 2022.17.3.06 rivers from six Mid-Atlantic USA locations (Richmond, Virginia to Washington, D.C.) Received: 12 September 2021 in 2018 and 2019 for mystery snails and co-occurring indigenous snails. A random Accepted: 13 April 2022 subset of each snail species (max N = 80) per location was assessed for population Published: 23 May 2022 demographics (size, sex), and brooding embryos were counted in mystery snails. Thematic editor: Elena Tricarico Because morphological identification can be difficult to discern from its congener, the Chinese mystery snail (Cipangopaludina chinensis), we used a mitochondrial Copyright: © Fowler et al. barcoding gene (COI) to confirm identity of H. japonica and also serve as a population This is an open access article distributed under terms of the Creative Commons Attribution License genetics marker. Our barcoding confirmed that the mystery snails detected in our (Attribution 4.0 International - CC BY 4.0). surveys were H. japonica, and that, compared to the indigenous range, its populations OPEN ACCESS. have low genetic diversity and limited genetic structure. Even so, H. japonica had the highest overall catch-per-unit-effort among all snails and sites. In demographic analyses, H. japonica populations skewed towards females, and females brooding live young were the largest across all sites. The number of live young ranged from 14 to 101/female (average: 52 live young/female). Further, a linear relationship existed between brooding female shell length and the number of live young for all sites, except one. Possible explanations could include site-level differences in abiotic or biotic parameters, but this requires further research. Altogether, the snail’s reproductive capacity documented here suggests that H. japonica has the potential to undergo additional population growth, especially if large females spread to new locations. Moreover, it highlights another example of an invasive species with high population abundance, demographic performance, and distributional range even with depauperate genetic diversity. Key words: Heterogen/Cipangopaludina japonica, gastropod, genetic paradox, invasion, North America Introduction Globally, freshwater biodiversity is at risk due to a number of leading anthropogenic concerns, including climate change, water pollution, flow modification, degradation of habitats, and invasion by exotic species (Dudgeon et al. 2006; Reid et al. 2019). Invasive species, in particular, rank Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 415 Virginia/D.C. Japanese mystery snail population genetics and demography as the second leading cause of freshwater biodiversity declines around the world because they may compete with, predate on, or displace indigenous flora and fauna (Parker et al. 1999; Dudgeon et al. 2006; Reid et al. 2019). Exotic freshwater gastropods, specifically, have invaded numerous indigenous ecosystems either through deliberate introductions or accidental anthropogenic transfer (Padilla and Williams 2004). Two invasive freshwater snail species, the Japanese mystery snail (Heterogen / Cipangopaludina / Bellamya / Viviparus japonica) and the Chinese mystery snail (C. chinensis), were intentionally transported from Japan to North America in ~ 1911 and ~ 1892, respectively, to be cultivated for human consumption (Prashad 1928; Clench and Fuller 1965). Both species now occur in tributaries throughout North America (Jokinen 1982; United States Geological Survey 2021). The exact species identities of the mystery snails detected in many North American locations remain unclear because identification via traditional visual morphology is challenging due to their morphological similarities (Smith 2000; Van Bocxlaer and Strong 2016). The presence of two morphs of C. chinensis in North America further hinders correct identification (Jokinen 1982, 1992; Van Bocxlaer and Strong 2016). In addition, their taxonomies remain in flux as they have each been assigned multiple scientific names, and debate still surrounds the phylogenetic structure of these species and related congeners (Perez et al. 2016). Indeed, recent evidence suggests that Japanese mystery snails belong to the genus Heterogen, and thus in this paper, we refer to them as Heterogen japonica (Saito and Kagawa 2020). Of the two species, snails morphologically identified as C. chinensis have been studied more extensively in introduced populations. As non-selective detritivores, Cipangopaludina chinensis consume benthic and epiphytic algae. In their introduced range, they compete with indigenous molluscs, as well as alter nutrient cycling, algal biomass, and microbial communities (Jokinen 1982; Bury et al. 2007; Clark 2009; Johnson et al. 2009; Olden et al. 2013). They have ovoviviparous reproduction (i.e., eggs hatch within the mother and develop inside before being expelled as juveniles), and females can live five years (Jokinen 1982, 1992; Stephen et al. 2013). Similarly, the Japanese mystery snail, H. japonica, acts as a filter-feeder and detritivore and can improve overall water quality and measures of lake productivity (Solomon et al. 2010; Van Bocxlaer and Strong 2016). However, this species can also negatively impact indigenous snail populations, likely due in part to exponential population growth stemming from their ovoviviparous reproductive strategy (Wolfert and Hiltunen 1968). Overall, little information exists about the life history of H. japonica in its invasive ranges, but this may be partially because of the difficulty in distinguishing between the two species, which could limit the association of characteristics to H. japonica. Moreover, few genetic studies have been used to identify the two mystery snail species in North America (but see Perez et al. 2016 and David and Cote 2019). Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 416 Virginia/D.C. Japanese mystery snail population genetics and demography Here, we collected mystery snails and co-occurring indigenous snails from six freshwater populations in Virginia and Washington, D.C. over two years. Our study provides a detailed understanding of the demographic features of indigenous and non-indigenous snails in these communities and provides further insight into the demographic success and geographic spread of mystery snails in these systems. Materials and methods Study design Field collections and demographic assessments We surveyed locations from Richmond to Washington D.C. for freshwater snails in July, August, and September 2018 and June and July 2019. We chose sites based on previous reports of collected “mystery snails” (i.e., species either named as Chinese mystery snails or Japanese mystery snails) to the United States Geological Surveys’ Invasive Species Program (https://www.usgs.gov/ecosystems/invasive-species-program), and ultimately we sampled six locations to encompass different Virginia/D.C. rivers or lakes (Table 1). Apple snails (Pomacea maculata) are also sometimes referred to as “mystery snails”; however, we specifically chose sites known to host Chinese / Japanese mystery snails, and apple snails are easily distinguished from C. chinensis and H. japonica. We used hand and visual surveys to collect indigenous and non-indigenous snails using a timed collection method (1 hour) along a ~ 30 m transect at a maximum water depth of 1 m. This provided a catch-per-unit effort (CPUE) method of assessing relative species abundance across all encountered snail species. We brought a random subset of putatively adult individuals of each snail species (max N = 80) to the laboratory for demographic analyses (sex, size). We used published keys and expert identification (R. Dillon, pers. comm.) to visually identify indigenous snails. We used the World Registry of Marine Species (WORMS, https://www.marinespecies.org/) as our primary taxonomic source. In mystery snails, the size at maturity for these populations is unknown, so we assessed all encountered snails > 15 mm shell length. We measured all snails for shell length (mm) and dissected them to determine sex (i.e., male, female, hermaphroditic). We collectively enumerated all brooding embryos (e.g., freshly encapsulated, angulated eggs, developing eggs, and juveniles sensu Van Bocxlaer and Strong 2016) in mystery snails. We also froze a sample of foot tissue from each mystery snail for species confirmation and population genetics analyses. DNA isolation, amplification, and sequencing of mystery snails We used foot tissue from mystery snails from each location to determine species identity (N = 10, Anacostia; N = 14, Lake Barcroft; N = 7, Gunston; Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 417 Virginia/D.C. Japanese mystery snail population genetics and demography N = 12, Bryan Park; N = 12, Leesylvania; N = 27, Rappahannock). We extracted DNA using a standard cetyl trimethyl ammonium bromide (CTAB)-ethanol precipitation protocol (France et al. 1996). We used the Geller et al. (2013) Universal COI invertebrate primers and newly designed Heterogen/Cipangopaludina COI primers (COI-F: CCACCTGCAGGATC AAAGAA; COI-R: TCCGGATTAGTTGGAACTGG) based on a H. japonica sequence (accession #: MK308324.1) to identify mystery snail species and perform population genetics analyses. We used the following PCR profile: 95 °C for 2 min; 30 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s; and 72 °C for 5 min (Steinberg et al. 2008). PCR products were purified using EXOSAP-IT (Applied Biosystems) and submitted for sequencing at Psomagen, USA (Rockville, MD). These sequences were deposited to GenBank (https://www.ncbi.nlm.nih.gov/genbank/) as accession numbers ON323055–ON323149. We compiled new Virginia/D.C. sequences with Japanese and Chinese mystery snail sequences from Asian and North American populations that were harvested from GenBank and BOLD (http://www.boldsystems.org/) (Supplementary material Table S1). Data analyses Genetic sequence alignment, analysis, and barcoding We aligned and manually inspected genetic sequences for ambiguities using Geneious 10.1.2 (Biomatters Ltd). Sequences were aligned without gaps using the ClustalW algorithm (Larkin et al. 2007). Following alignment and curation, our COI sequence fragment was 545 base-pairs (bp). We aligned these sequences with those available in Genbank/BOLD (per above), and the overlapping sequence fragment among all sequences was 404 bp (i.e., we had to further truncate the overall sequence length to match our sequences with these published sequences). We collapsed sequences into haplotypes using TCS v.1.21 (Clement et al. 2000). The optimal nucleotide substitution model was selected based on the Akaike Information Criterion in jModelTest2 (Darriba et al. 2012) and used in Bayesian phylogeny reconstructions with MrBayes (Huelsenbeck and Ronquist 2001). The substitution model was set to GTR with four gamma categories; the rate variation set to gamma; and MCMC settings were default. Along with all available GenBank or BOLD mystery snail sequences overlapping with our H. japonica and C. chinensis sequences, we also included nine additional sequences of Elimia virginica and four sequences of Campeloma decisum from Virginia/D.C. for comparative purposes (Table S1). We used a Nodilittorina pyramidalis (GenBank: MN389024) sequence as our outgroup and to root the tree. We calculated pairwise FSTs using Arlequin311, constructed a resemblance matrix of populations from Table S1 using Primer7 and used an nMDS plot and boxplots to compare population differences in haplotype identities and frequencies. Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 418 Virginia/D.C. Japanese mystery snail population genetics and demography While our phylogenetic tree included all published sequences from the indigenous and non-indigenous ranges of H. japonica and C. chinensis (Table S1), our nMDS analysis only included populations that had population sizes of ? 3 individuals per population. For these populations, we also calculated haplotype (h) and nucleotide (?) diversity values using Arlequin311, and also compared the total h and ? for all indigenous versus non- indigenous sequences. Because there were too few samples from C. chinensis’ non-indigenous range, this latter analysis only examined comparative population level indices in H. japonica. In Arlequin, we also calculated Tajima’s D and Fu’s Fs for H. japonica in its indigenous and non-indigenous ranges (all Japanese and all Virginia/DC populations, respectively) to look for evidence of population bottlenecks or recent population expansions in the two regions. Population demography We calculated a catch-per-unit-effort for each species at each site by dividing the total number of snails found, by species, by the total search time. We first tested whether there were differences in H. japonica snail shell length due to sampling year. Finding no differences, we combined all data and used a general linear model to examine the influence of site and snail sex (male, brooding female, non-brooding female) on snail shell length, followed by pairwise comparisons using Tukey’s tests. A generalized linear model using a negative binomial distribution and log-link function compared whether the number of live young found in H. japonica females differed by site, using shell length as a covariate. Pairwise comparisons between sites were made using sequential Bonferroni corrections. A general linear model compared the relationships between shell length of brooding H. japonica females and the number of live young across sites, followed by pairwise comparisons using Tukey’s tests. Results Genetic analyses We included 193 sequences in our dataset (Table S1), including Heterogen japonica from indigenous (N = 20) and non-indigenous (N = 90) ranges (82 new sequences from Virginia/D.C.), C. chinensis from indigenous (N = 85) and non-indigenous (N = 4) ranges and Elimia virginica (N = 9) and Campeloma decisum (N = 4) from Virginia. Sequences were collapsed into 37 haplotypes: 11 haplotypes were H. japonica (8 only in the indigenous range, 2 only in the non-indigenous range, and 1 shared between ranges), 20 were C. chinensis (18 only in the indigenous range, 1 only in the non- indigenous range, and 1 shared between ranges), 5 were E. virginica from Virginia, and 1 was C. decisum from Virginia (Figure 1A). Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 419 Virginia/D.C. Japanese mystery snail population genetics and demography Figure 1. A) Phylogenetic reconstruction of the COI-fragment of indigenous and non-indigenous snails. Posterior probabilities for each clade are noted on the nodes. Two major clades are represented for the two mystery snail species: H. japonica (HJ) (haplotypes 21–31) and C. chinensis (CC) (haplotypes 1–20) from indigenous Asia and non-indigenous North America. North American indigenous snails, Campeloma decisum (CD) and Elimia virginica (EV), are represented by haplotype 37 and haplotypes 32–26, respectively. The tree is rooted using an outgroup sequence from Nodilittorina pyramidalis (MN389024). The green coloring on the tree signifies shared haplotypes between the indigenous and non-indigenous regions for each mystery snail species. (B) nMDS plot of pairwise FSTs from H. japonica and C. chinensis populations in the indigenous and non-indigenous ranges, based on previous records and newly sampled Virginia/D.C. locations in our study (represented by the oval surrounding these sites). While we detected no C. chinensis in our North American sampling, we included North American C. chinensis sequences (i.e., Hawaii, New York, and Ontario, Canada) that had been extracted from GenBank (Table S1). The New York (David and Cote 2019) and Hawaiian (Hayes et al. 2019) sequences shared haplotype h16 and were subsumed within a C. chinensis clade that contained multiple sequences (h17–h20) from the indigenous range (Figure 1A). The Ontario sequence (Center for Biodiversity Genomics) shared a frequent hapolotype (h1) that was part of a C. chinensis clade (h1– Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 420 Virginia/D.C. Japanese mystery snail population genetics and demography h4) that only included individuals from Japan. Given the limited number of non-indigenous C. chinensis samples available for comparison, we did not further analyze the C. chinensis data for indigenous/non-indigenous comparisons, except for the nMDS plot where we included C. chinensis from the indigenous range (Figure 1B). Within the H. japonica clade, all non-indigenous samples, including Virginian/D.C. samples, fell within a clade containing Japanese records (Figure 1A). However, Japan was the only indigenous region where published sequences existed. All non-indigenous North American records (N = 90) were assigned to three haplotypes: haplotype h23 was identified in New York (David and Cote 2019) and Rappahannock and shared with several populations in the indigenous range; haplotype h21 was found at all Virginian/D.C. sites, Texas (Perez et al. 2016) and Florida (Sengupta et al. 2009); haplotype h22 was only found in two Virginian (Gunston Cove and Rappahannock) sites. Haplotypes h21 and h22 did not match any of the indigenous records extracted from GenBank, most likely because the indigenous range is vast and undersampled (Figure 1A). This result can also be seen in the nMDS plot (Figure 1B) where the non-indigenous North American sequences were not subsumed within the Japanese indigenous sequences. Haplotype (h) and nucleotide diversity (?) analyses of indigenous versus non-indigenous populations found nearly 7x greater h diversity and 48x greater ? diversity in the indigenous range. Tajima’s D was not significant for either region. Fu’s Fs was significant and negative for the non-indigenous range (Table 2), suggesting a recent population expansion of the species in this region following introduction events. Snail field surveys Invasive mystery snails were hand-collected at all locations during the timed survey, with highest counts at the Rappahannock site and lowest at Leesylvania State Park (Figure 2). Mystery snails were most often found attached to hard surfaces (e.g., wooden docks, tree limbs and downed tree trunks, cement walls, and rock boulders) and were very rarely found attached to living plant material or on the bare sediment surface (except for Leesylvania, where they were found along the edge of a macrophyte bed). In addition to the invasive species, the following nine indigenous snail species were also encountered and collected: Amnicola limosa, Campeloma decisum, Elimia virginica, Lymnaea humilis, Lyogyrus granum, Physella acuta, Physella pomilia, and Helisoma trivolvis (Figure 2). Including the invasive mystery snail, the species richness of snails at our sites ranged from two species in Gunston Cove to seven species in Lake Barcroft. The invasive mystery snails made up between 18% (N = 19/104 from Leesylvania) and 56% (N = 98/174 from Gunston Cove) of the total number of hand- collected snails. Heterogen japonica had the highest overall catch-per-unit- effort (CPUE) across all sites at 0.92 individuals hand collected/minute Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 421 Virginia/D.C. Japanese mystery snail population genetics and demography Table 1. Total number and male to female ratios of Heterogen japonica hand collected during a timed 60 min search from each location July–September 2018 and June–July 2019 (*only sampled in 2018). The abundance and percent of brooding female snails and the average number of embryos (± standard error) and maximum and minimum number for those that had embryos is also given. Site Latitude, Longitude Total # M:F ratio % Female No. (%) Average Brood No. ± collected Brooding SE (Min–Max) Anacostia* 38°52?16.2?N; 76°59?19.4?W 59 1: 1.68 63% 32 (86%) 63 ± 3.6 (1–97) Gunston Cove 38°46?40.7?N; 77°02?55.7?W 98 1: 2.06 67% 52 (79%) 101 ± 5.6 (1–188) Bryan Park 37°35?48.1?N; 77°28?14.3?W 136 1: 1.49 60% 63 (83%) 47 ± 2.6 (2–95) Lake Barcroft 38°50?48.6?N; 77°10?04.3?W 113 1: 1.51 60% 49 (72%) 55 ± 7.1 (2–197) Leesylvania* 38°35?06.2?N; 77°15?47.2?W 19 1: 2.8 74% 14 (100%) 56 ± 4.2 (24–78) Rappahannock 38°14?39.4?N; 77°13?33.6?W 156 1: 1.5 60% 77 (86%) 14 ± 0.9 (1–42) Table 2. Regional and population-level diversity indices and neutrality tests for Heterogen japonica using newly contributed sequences and published sequences (see Methods). Population-level indices include populations with > 3 individuals. Regional analyses include all sequences from Table S1. Per population or region, N = number of individuals; a = number of alleles; h = haplotype diversity; ? = nucleotide diversity. For regional analyses, Tajima’s D and Fu Fs statistics, along with their respective p values, are denoted. Bolded values represent significant deviation from neutrality. Site N a h ± S.E. ? ± S.E. Tajima’s D p (Dsim < Dobs) Fu’s Fs p (Fssim < Fsobs) INDIGENOUS Aichi, Japan 4 2 0.6667 ± 0.2041 0.00179 ± 0.00166 Hyogo, Okayama, Japan 3 1 0.0000 ± 0.0000 0.00000 ± 0.00000 Osaka, Nara, Wakayama, Japan 4 2 0.5000 ± 0.2652 0.00124 ± 0.00153 Shiga, Japan 5 4 0.8000 ± 0.1721 0.00941 ± 0.00635 All Japanese Populations 20 9 0.8579 ± 0.0611 0.00771 ± 0.00466 ?0.770 0.245 ?1.619 0.193 NON-INDIGENOUS Anacostia, Washington, D.C. 10 1 0.0000 ± 0.0000 0.00000 ± 0.00000 Belle Haven, Virginia 7 2 0.2857 ± 0.1964 0.00000 ± 0.00000 Bryan Park, Virginia 12 1 0.0000 ± 0.0000 0.00000 ± 0.00000 Potomac, Virginia 3 1 0.0000 ± 0.0000 0.00000 ± 0.00000 Lake Barcroft, Virginia 14 2 0.2637 ± 0.1360 0.00065 ± 0.00086 Leesylvania, Virginia 12 1 0.0000 ± 0.0000 0.00000 ± 0.00000 Rappahannock, Virginia 17 2 0.2206 ± 0.1208 0.00000 ± 0.00000 All Virginian/D.C. Populations 90 3 0.1281 ± 0.0474 0.00016 ± 0.00038 ?0.784 0.214 ?3.159 0.000 (Figure 2). However, there were some indigenous snails with higher CPUEs at particular sites (i.e., C. decisum at Anacostia – 1.33 and E. virginica at Leesylvania – 1.33 and Rappahannock – 1.36) (Figure 2). Heterogen japonica population demographics The largest snails (shell length) across all snail species and sites were brooding H. japonica females (average shell length 48.93 ± 9.76 mm standard error). Non-brooding females from Gunston Cove measured significantly smaller (average 34.79 ± 4.69 mm) than all other site and sex combinations (average 44.81 ± 11.16 mm) (Figure 3), resulting in a significant interaction between site and sex on H. japonica shell length (N = 566, LM, F(10,555) = 20.86, p < 0.001). In the majority of locations, male H. japonica were less abundant than females, with an average male to female sex ratio of 1:1.63 (Table 1). In addition, of those females collected, the majority (between 72% and 100% depending on the site) were brooding live young. The average number of brooding young in a single female across sites was 52 live young. After accounting for shell length, there was a significant difference in the number of embryos between sites (N = 286, GLM, df = 5, Wald Chi-Square Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 422 Virginia/D.C. Japanese mystery snail population genetics and demography Figure 2. Catch-per-unit-effort for each indigenous and non-indigenous snail species hand collected during a timed 60 min search from each location July–September 2018 and June–July 2019 (except Anacostia and Leesylvania, which were only sampled in 2018). Values represent how many snails could be hand collected per minute. Figure 3. Shell lengths (mm) by site of male, brooding female, and non-brooding female Heterogen japonica hand collected during a timed 60 min search from each location July–September 2018 and June–July 2019 (except Anacostia and Leesylvania, which were only sampled in 2018). Box plots represent the interquartile (IQ) range (i.e., the middle 50% of the records), the vertical line is the median, and the whiskers are the highest and lowest values which are no greater than 1.5 times the IQ range. Outliers (i.e., black circles) are values between 1.5 and 3 times the IQ range, beyond the whiskers. The dashed line at 45 mm represents the overall average size of invasive mystery snails across all sexes and sites. = 134.07, p < 0.001), with the highest average number of embryos in females from Gunston Cove (101 embryos) and the lowest in females from the Rappahannock (14 embryos) (Table 1, Figure 4A). With the exception of females from the Rappahannock and Gunston Cove, larger females were Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 423 Virginia/D.C. Japanese mystery snail population genetics and demography Figure 4. (A) Number of live young found in brooding female Heterogen japonica by site. The boxes represent the interquartile (IQ) range (i.e., the middle 50% of the records), the horizontal line is the median, and the whiskers are the highest and lowest values which are no greater than 1.5 times the IQ range. Outliers (i.e., black circles) are values between 1.5 and 3 times the IQ range, beyond the whiskers. Different letters above each box plot indicate significant differences (p < 0.05). (B) Linear relationships and the strength of those relationships (R2 value) between the shell lengths (mm) of brooding female H. japonica and the number of live, internal embryos counted during dissection. found with higher numbers of live young during dissections (Figure 4B). Therefore, the relationship between shell length of a brooding female and the number of live embryos that was counted during dissection differed between sites (N = 286, LM, F(5,280) = 54.05, p < 0.001, Adjusted R2 = 0.482). Brooding females from the Rappahannock were never observed with more than 42 live young, while there were clear positive associations between shell length and numbers of live young at all other sites (Figure 4B). Discussion Here, we genetically confirmed that mystery snails present in Virginia and Washington, D.C., USA were the Japanese mystery snail, H. japonica, and that these non-indigenous populations were genetically depauperate. In demographic analyses, we determined that mystery snails were the most abundant snails present and that their populations were skewed towards large brooding females, suggesting stable and successfully reproducing populations. Genetic confirmation and population genetics of H. japonica While Van Bocxlaer and Strong (2016) previously identified H. japonica in the Potomac River in Alexandria, Lake Barcroft, and Gunston Cove, Virginia via morphological distinctions, here we confirm identification of H. japonica via genetic methods. Moreover, we detected little to no genetic structure in the populations of H. japonica from the United States. All sequences, regardless of collection site, were comprised of just three haplotypes, and diversity indices (h and ?) were 7 and 48 times lower in the non-indigenous regions, suggesting very limited genetic diversity for the invasive snail in its non-indigenous range. Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 424 Virginia/D.C. Japanese mystery snail population genetics and demography Many non-indigenous populations exhibit significantly lower genetic diversity, which may occur as a result of founder effects (Dlugosch and Parker 2008), where just a subset of a species’ source genetic diversity is transported (naturally or anthropogenically) to a new region, resulting in substantially lower genetic diversity compared to the source (Barton and Charlesworth 1984; Grosberg and Cunningham 2001). Frequent additions to the founding population could introduce new genotypes and increase standing genetic variation in the non-indigenous range that could help alleviate deleterious effects of low genetic diversity (Roman and Darling 2007; Dlugosch and Parker 2008; Lejeusne et al. 2014). However, even though we observed lower haplotype and nucleotide diversity in its non- indigenous populations, H. japonica was the most abundant snail at the majority of our sample sites and also demonstrated a very high reproductive capacity (discussed further below). This species is another example of a demographically successful invasive species demonstrating limited genetic diversity—and thus represents a “genetic paradox”. The genetic paradox refers to species that exhibit significantly reduced genetic diversity in founding populations, yet are demographically successful by adapting to novel environments (Estoup et al. 2016). While seemingly paradoxical, these species may have biological traits that allow them to circumvent possible deleterious effects predicted in founding populations (e.g., accumulation of deleterious alleles due to low founding sizes and subsequent genetic drift) (Schrieber and Lachmuth 2017). However, neutral markers commonly used in single-gene approaches may not reflect genetic diversity across the genome or genes associated with ecologically relevent traits (Estoup et al. 2016). Thus, further examination of genetic diversity across multiple markers could reveal genetic mechanisms for the demographic success of mystery snails under a scenario of depauperate genetic diversity, as in the invaded North American range. In addition, it was not possible for us to pinpoint source locations from the indigenous range for the species’ introduction using genetic data presently available. This is because the genetic diversity in that region is vast in comparison to what we sampled in the non-indigenous range (e.g., Blakeslee et al. 2008). Greater spatiotemporal sampling of indigenous and non-indigenous ranges could provide better understanding of the impact of genetic diversity on the species’ distribution and its spread in the non- indigenous range, as well as likely sources of introduction. Population demography of H. japonica While the invasive Japanese mystery snail H. japonica was the most frequently encountered snail across all sites, two indigenous snail species had higher catch-per-unit-efforts at particular sites (i.e., Campeloma decisum at Anacostia and Elimia virginica at Leesylvania and Rappahannock). One of these, the pointed campeloma – C. decisum, was the largest indigenous Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 425 Virginia/D.C. Japanese mystery snail population genetics and demography snail we encountered and can reach sizes of up to 40 mm shell length (Brown et al. 1989). Brown et al. (1989) observed that individuals can aggregate at high densisties of up to 800/m2, but we did not observe large aggregations at our sites. Similar to H. japonica, C. decisum is also a deposit and filter feeder and has ovoviviparous (broods live young) reproduction (Brown et al. 1989). The Piedmont elimia, E. virginica, can reach sizes of up to 33 mm shell length, is dioecious, and has been observed at densities over 400 individuals/m2 (Smith 1980). This species grazes on epilithic periphyton (Harman 2000), in contrast to H. japonica and C. decisum. Previous work has also noted that invasive populations of H. japonica can attain high densities and likely has significant negative effects on the local ecosystem (Wolfert and Hiltunen 1968). Wolfert and Hiltunen (1968) reported that seine fishermen in Lake Erie, Pennsylvania, USA could catch two tons of the species in a single haul. Similar to our study, Wolfert and Hiltunen (1968) found that the second most frequently encountered snails were either C. decisum or a pleurocerid snail similar to E. virginica. It is likely that these species overlap in diet and may even compete for food in areas where there are high densities; yet studies thus far examining competition among indigenous freshwater snails and non-indigenous mystery snails have concentrated on C. chinesis (e.g., Jokinen 1982; Bury et al. 2007; Clark 2009; Johnson et al. 2009; Olden et al. 2013). While it is likely that the two mystery snails have similar ecological impacts because they share many of the same demographic and morphological traits, more experimental work describing the impacts of H. japonica on indigenous species and systems is needed to compare their ecosystem influences. The broad size range of H. japonica collected for both sexes and the high proportion of brooding females in the populations suggests that these multigenerational populations successfully reproduce in these locations. The reproductive mode (i.e., ovoviviparous; eggs hatch within the mother before being expelled as juveniles) and reproductive capacity of this species both contribute to its success as an invader (Van Bocxlaer and Strong 2016). Organisms that brood live young are often less constrained by possible Allee effects (i.e., reduced or negative population growth at low population densities) that could emerge in founding populations (Johannesson 1988). Because ovoviviparous species can release numerous, crawl-away young that do not disperse far from the parent settlement, this reproductive strategy can enhance their colonization success and population growth in newly founded regions; indeed, some of the most globally widespread and invasive aquatic gastropods include brooders (e.g., Potamopyrgus antipodarum; Alonso and Castro-Diez 2008). Ovoviviparity has likely enhanced both H. japonica’s and C. chinensis’ colonization success, spread, and population growth in freshwater systems throughout North America. For example, the estimated annual production of an invasive population of C. chinensis from a Nebraska reservoir was ~ 2.2–3.7 million Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 426 Virginia/D.C. Japanese mystery snail population genetics and demography young (Stephen et al. 2013). This reproductive strategy may have also been a contributing factor in its demographic success and geographic spread in North America despite low genetic diversity in the region as detected in our study. Site-level differences in H. japonica In general, brooding female H. japonica were significantly larger than males, due mainly to the presence of the large brood pouch located in the same location as the much smaller testes in males (Van Bocxlaer and Strong 2016). However, at the Rappahannock site, we found a smaller size range of brooding females in comparison to other locations. Female H. japonica in this survey contained developing embryos of several sizes and stages of development, a trait found in other species of Viviparidae snails (Jakubik 2007). However, this characteristic also varied across sites. In general, female shell length and embryo number were positively related to one another except for two locations – Gunston Cove and Rappahannock. Female H. japonica in their indigenous range in Japan release live young between April and October, and the number of live brooding young was between 10 and 120 (Taki 1981). Stephen et al. (2013) found that C. chinensis females (N = 29) (e.g., species identification was not genetically confirmed) collected in southeast Nebraska contained an average of 25 embryos per female, while the average across all sites in this survey was 2.5x higher (N = 132, average 62, range 16–109). An earlier survey of only seven female H. japonica from northern Virginia collected in September 2012 found an average of 108 live young (range 46–220) (Van Bocxlaer and Strong 2016). It is possible that there were various abiotic and biotic factors that could explain these site-level differences detected between our study and others; for example, the Stephen et al. (2013) survey occurred in September, possibly at the end of the breeding season, while the survey presented here occurred earlier during the summer months. The warmer water temperatures in Virginia/D.C. may have also contributed to the higher abundances of embryos in females as compared to other northern populations. Moreover, snail density, water quality, nutrients, day length, parasites and food availability all likely vary by location and could influence snail growth and reproductive output in these different locations (Ter Maat 2007; Sandland and Josephson 2017; Song et al. 2017; Dickens et al. 2018; Muñoz et al. 2018). Conversely, a genetic explanation for these demographic differences across sites in Virginia/D.C. is unlikely given the little genetic differentiation we observed among populations and low genetic diversity in all non- indigenous populations. Even so, the reproductive mode and the number of developing embryos documented in H. japonica in Virginia/D.C. populations suggest that this species has the potential to undergo additional population growth, especially if large females spread to new locations (Keller et al. 2007). Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 427 Virginia/D.C. Japanese mystery snail population genetics and demography Although the populations studied here are genetically depauperate, the snails are successfully reproducing, and thus appear to represent another invasive species demonstrating a genetic paradox. The species’ reproductive strategy as well as the presence of ecologically relevant genes may have helped it avoid deleterious effects often associated with low genetic diversity. Finally, while much of the literature from laboratory and field studies have identified North American mystery snails as C. chinensis, our study suggests that Japanese mystery snails are the dominant mystery snail in Virginia. Given the morphological similarities between the two species, genetic confirmation is needed going forward to ensure any new reports and research correctly identifies these two invasive species. Acknowledgements We thank the Fowler lab for dissecting snails (Darby Pochtar, Alex Mott, Allison Assur, and Julia Czarnecki) and Dr. Robert Dillon for identifications. We also thank the anonymous reviewers for their comments, which greatly improved the manuscript. Funding declaration George Mason University start up funds to AEF, East Carolina University start-up funds to AMHB, a Washington Field Biologists’ Club grant to AEF, and GMU’s undergraduate research program (OSCAR) grant to GAL supported this work. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Author’s contribution AEF conceptualized the research, designed the sampling and methods, collected the data, completed the data analysis, interpreted the data, wrote the original draft, and reviewed and edited all other drafts. GAL collected the data and reviewed and edited all other drafts. AMHB designed the sampling and methods, collected the data, completed the data analysis, interpreted the data, wrote the original draft, and reviewed and edited all other drafts. Ethics and permits With submission of this article, the authors have complied with the institutional and/or national policies governing the humane and ethical treatment of the experimental subjects. Maryland Department of Natural Resources Scientific Collection Permit Number SCP2018861. Virginia Department of Game and Inland Fisheries Scientific Collection Permit Number 062276. References Alonso A, Castro-Diez P (2008) What explains the invading success of the aquatic mud snail Potamopyrgus antipodarum (Hydrobiidae, Mollusca)? Hydrobiologia 614: 107–116, https://doi.org/10.1007/s10750-008-9529-3 Barton NH, Charlesworth B (1984) Genetic revolutions, founder effects, and speciation. Annual Review of Ecology and Systematics 15: 133–164, https://doi.org/10.1146/annurev.es.15.110184.001025 Blakeslee AMH, Byers JE, Lesser ME (2008) Resolving cryptogenic histories using host and parasite genetics. Molecular Ecology 17: 3684–3696, https://doi.org/10.1111/j.1365-294X.2008. 03865.x Brown K, Varza D, Richardson T (1989) Life histories and population dynamics of two subtropical snails (Prosobranchia: Viviparidae). Journal of the North American Benthological Society 8: 222–228, https://doi.org/10.2307/1467325 Bury JA, Sietman BE, Karns BN (2007) Distribution of the non-native Viviparid snails, Bellamya chinensis and Viviparus georgianus, in Minnesota and the first record of Bellamya japonica from Wisconsin. Journal of Freshwater Ecology 22: 697–703, https://doi.org/10.1080/02705060.2007.9664830 Clark GT (2009) Distribution, growth, and competitive impacts of the exotic Chinese mystery snail (Bellamya chinesis) in the James River, southwest Missouri. MSc Thesis, Missouri State University Clench WJ, Fuller SLH (1965) The genus Viviparus (Viviparidae) in North America. Occasional Papers on Mollusks 2(32): 385–412 Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 428 Virginia/D.C. Japanese mystery snail population genetics and demography Clement M, Posada DCKA, Crandall KA (2000) TCS: a computer program to estimate gene genealogies. Molecular Ecology 9: 1657–1659, https://doi.org/10.1046/j.1365-294x.2000.01020.x Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772, https://doi.org/10.1038/nmeth.2109 David AA, Cote SC (2019) Genetic evidence confirms the presence of the Japanese mystery snail, Cipangopaludina japonica (von Martens, 1861) (Caenogastropoda: Viviparidae) in northern New York. BioInvasions Records 8: 793–803, https://doi.org/10.3391/bir.2019.8.4.07 Dickens KL, Capinera JL, Smith TR (2018) Effects of density and food deprivation on growth, reproduction, and survival of Lissachatina fulica. American Malacological Bulletin 36: 57–61, https://doi.org/10.4003/006.036.0115 Dlugosch KM, Parker IM (2008) Founding events in species invasions: genetic variation, adaptive evolution, and the role of multiple introductions. Molecular Ecology 17: 431–449, https://doi.org/10.1111/j.1365-294X.2007.03538.x Dudgeon D, Arthington AH, Gessner MO, Kawabata ZI, Knowler DJ, Lévêque C, Naiman RJ, Prieur-Richard A-H, Soto D, Stianssny MLJ, Sullivan CA (2006) Freshwater biodiversity: importance, threats, status and conservation challenges. Biological Reviews 81: 163–182, https://doi.org/10.1017/S1464793105006950 Estoup A, Ravigné V, Hufbauer R, Vitalis R, Gautier M, Facon B (2016) Is there a genetic paradox of biological invasion? Annual Review of Ecology, Evolution, and Systematics 47: 51–72, https://doi.org/10.1146/annurev-ecolsys-121415-032116 France SC, Rosel PE, Ewann J (1996) DNA sequence variation of mitochondrial large-subunit rRNA. Molecular Marine Biology and Biotechnology 5(1): 15–28 Geller J, Meyer C, Parker M, Hawk H (2013) Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all?taxa biotic surveys. Molecular Ecology Resources 13: 851–861, https://doi.org/10.1111/1755-0998.12138 Grosberg R, Cunningham CW (2001) Genetic structure in the sea. In: Bertness MD, Gaines S, Hay ME (eds), Marine Community Ecology, Sinauer Associates, Sunderland, Massachusetts, pp 61–84 Harman WN (2000) Diminishing species richness of mollusks in Oneida Lake, New York State, USA. Nautilus 114: 120–126 Hayes KA, Cowie RH, Thiengo SC (2009) A global phylogeny of apple snails: Gondwanan origin, generic relationships, and the influence of outgroup choice (Caenogastropoda: Ampullariidae). Biological Journal of the Linnean Society 98: 61–76, https://doi.org/10.1111/j. 1095-8312.2009.01246.x Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755, https://doi.org/10.1093/bioinformatics/17.8.754 Jakubik B (2007) Egg number-female body weight relationship in freshwater snail (Viviparus viviparus L.) population in a reservoir. Polish Journal of Ecology 55(2): 325–336 Johannesson K (1988) The paradox of Rockall: why is a brooding gastropod (Littorina saxatilis) more widespread than one having a planktonic larval dispersal stage (L. littorea)? Marine Biology 99: 507–513, https://doi.org/10.1007/BF00392558 Johnson PT, Olden JD, Solomon CT, Vander Zanden MJ (2009) Interactions among invaders: community and ecosystem effects of multiple invasive species in an experimental aquatic system. Oecologia 159: 161–170, https://doi.org/10.1007/s00442-008-1176-x Jokinen EH (1982) Cipangopaludina chinensis (Gastropoda: Viviparidae) in North America, review and update. Nautilus 96: 89–95 Jokinen EH (1992) The Freshwater Snails (Mollusca: Gastropoda) of New York State. New York State Museum, Albany, NY, 112 pp Keller RP, Drake JM, Lodge DM (2007) Fecundity as a basis for risk assessment of nonindigenous freshwater molluscs. Conservation Biology 21: 191–200, https://doi.org/10.1111/j.1523-1739. 2006.00563.x Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam, H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins, DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948, https://doi.org/10.1093/ bioinformatics/btm404 Lejeusne C, Saunier A, Petit N, Béguer M, Otani M, Carlton JT, Rico C, Green AJ (2014) High genetic diversity and absence of founder effects in a worldwide aquatic invader. Scientific Reports 4: 1–9, https://doi.org/10.1038/srep05808 Muñoz JCV, Hilt S, Horák P, Knopf K (2018) Impact of trematode infections on periphyton grazing rates of freshwater snails. Parasitology Research 117: 3547–3555, https://doi.org/10. 1007/s00436-018-6052-y Olden JD, Ray L, Mims MC, Horner-Devine MC (2013) Filtration rates of the non-native Chinese mystery snail (Bellamya chinensis) and potential impacts on microbial communities. Limnetica 32: 107–120, https://doi.org/10.23818/limn.32.11 Padilla DK, Williams SL (2004) Beyond ballast water: aquarium and ornamental trades as sources of invasive species in aquatic ecosystems. Frontiers in Ecology and the Environment 2: 131–138, https://doi.org/10.1890/1540-9295(2004)002[0131:BBWAAO]2.0.CO;2 Parker IM, Simberloff D, Lonsdale WM, Goodell K, Wonham M, Kareiva PM, Williamson MH, von Holle B, Moyle PB, Byers JE, Goldwasser L (1999) Impact: toward a framework Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 429 Virginia/D.C. Japanese mystery snail population genetics and demography for understanding the ecological effects of invaders. Biological Invasions 1: 3–19, https://doi.org/10.1023/A:1010034312781 Perez B, Segrest A, Minton R, Campos S, Burks R (2016) First record of Japanese mystery snail Cipangopaludina japonica (von Martens, 1861) in Texas. Check List 12: 1–17, https://doi.org/10.15560/12.5.1973 Prashad B (1928) Recent and fossil Viviparidae. A study in distribution, evolution and palaeogeography. Memoirs of the Indian Museum 8: 153–252 Reid AJ, Carlson AK, Creed IF, Eliason EJ, Gell PA, Johnson PT, Kidd KA, MacCormack TJ, Olden JD, Ormerod SJ, Smol JP, Taylor WW, Tockner K, Vermaire JC, Dudgeon D, Cooke SJ (2019) Emerging threats and persistent conservation challenges for freshwater biodiversity. Biological Reviews 94: 849–873, https://doi.org/10.1111/brv.12480 Roman J, Darling JA (2007) Paradox lost: genetic diversity and the success of aquatic invasions. Trends in Ecology and Evolution 22: 454–464, https://doi.org/10.1016/j.tree.2007.07.002 Saito T, Kagawa O (2020) New insights from museum specimens: a case of Viviparidae (Caenogastropoda: Mollusca) in Iwakawa’'s collection preserved in the National Museum of Nature and Science, Tokyo. Biodiversity Data Journal 8: e52233, https://doi.org/10.3897/BDJ.8.e52233 Sandland GJ, Josephson KA (2017) Nutrient availability modulates both host and parasite life histories in a snail-trematode interaction. Diseases of Aquatic Organisms 126: 135–142, https://doi.org/10.3354/dao03169 Schrieber K, Lachmuth S (2017) The genetic paradox of invasions revisited: the potential role of inbreeding × environment interactions in invasion success. Biological Reviews 92): 939– 952, https://doi.org/10.1111/brv.12263 Sengupta ME, Kristensen TK, Madsen H, Jørgensen A (2009) Molecular phylogenetic investigations of the Viviparidae (Gastropoda: Caenogastropoda) in the lakes of the Rift Valley area of Africa. Molecular Phylogenetics and Evolution 52: 797–805, https://doi.org/10.1016/j. ympev.2009.05.007 Smith DG (1980) Goniobasis virginica (Gastropoda: Pleuroceridae) in the Connecticut River. The Nautilus 94(2): 50–54 Smith DG (2000) Notes on the taxonomy of introduced Bellamya (Gastropoda: Viviparidae) species in northeastern North America. The Nautilus 114: 31–37 Solomon CT, Olden JD, Johnson PT, Dillon RT, Vander Zanden MJ (2010) Distribution and community-level effects of the Chinese mystery snail (Bellamya chinensis) in northern Wisconsin lakes. Biological Invasions 12: 1591–1605, https://doi.org/10.1007/s10530-009-9572-7 Song Z, Zhang J, Jiang X, Xie Z (2017) Linking environmental factors, life history and population density in the endangered freshwater snail Margarya melanioides (Viviparidae) in Lake Dianchi, China. Journal of Molluscan Studies 83: 261–269, https://doi.org/10.1093/ mollus/eyx024 Steinberg MK, Krimsky LS, Epifanio CE (2008) Induction of metamorphosis in the Asian shore crab Hemigrapsus sanguineus: effects of biofilms and substratum texture. Estuaries and Coasts 31: 738–744, https://doi.org/10.1007/s12237-008-9063-6 Stephen BJ, Allen CR, Chaine NM, Fricke KA, Haak DM, Hellman ML, Kill RA, Nemec KT, Pope KL, Smeenk NA, Uden DR, Unstad KM, VanderHam AE, Wong A (2013) Fecundity of the Chinese mystery snail in a Nebraska reservoir. Journal of Freshwater Ecology 28: 439–444, https://doi.org/10.1080/02705060.2013.769127 Taki A (1981) The fecundity of a mud snail, Cipangopaludina japonica. Internationale Vereinigung für theoretische und angewandte Limnologie: Verhandlungen 21: 1637–1639, https://doi.org/10.1080/03680770.1980.11897251 Ter Maat A, Zonneveld C, de Visser JAG, Jansen RF, Montagne-Wajer K, Koene JM (2007) Food intake, growth, and reproduction as affected by day length and food availability in the pond snail Lymnaea stagnalis. American Malacological Bulletin 23: 113–120, https://doi.org/ 10.4003/0740-2783-23.1.113 United States Geological Survey (2021) NAS - Nonindigenous Aquatic Species. https://nas.er. usgs.gov/default.aspx (accessed 14 April 2021) Van Bocxlaer B, Strong EE (2016) Anatomy, functional morphology, evolutionary ecology and systematics of the invasive gastropod Cipangopaludina japonica (Viviparidae: Bellamyinae). Contributions to Zoology 85: 235–263, https://doi.org/10.1163/18759866-08502005 Wolfert DR, Hiltunen JK (1968) Distribution and abundance of the Japanese snail, Viviparus japonicus, and associated macrobenthos in Sandusky Bay, Ohio. The Ohio Journal of Science 68(1): 32–40 Supplementary material The following supplementary material is available for this article: Table S1. Site names, country, and description of genetic sequences obtained for indigenous and non-indigenous populations of Cipangopaludina chinensis and Heterogen japonica used to construct phylogenetic trees. This material is available as part of online article from: http://www.reabic.net/aquaticinvasions/2022/Supplements/AI_2022_Fowler_etal_SupplementaryMaterial.xlsx Fowler et al. (2022), Aquatic Invasions 17(3): 415–430, https://doi.org/10.3391/ai.2022.17.3.06 430