fpls-11-00687 May 22, 2020 Time: 19:45 # 1
ORIGINAL RESEARCH
published: 26 May 2020
doi: 10.3389/fpls.2020.00687
Chilling and Heat Stress-Induced
Physiological Changes and
MicroRNA-Related Mechanism in
Sweetpotato (Ipomoea batatas L.)
Jingjing Yu1,2,3, Dan Su1,2, Dongjing Yang4,5, Tingting Dong1,2, Zhonghou Tang4,5,
Hongmin Li4,5, Yonghua Han1,2, Zongyun Li1,2* and Baohong Zhang3*
1 Institute of Integrative Plant Biology, School of Life Sciences, Jiangsu Normal University, Xuzhou, China, 2 Jiangsu Key
Laboratory of Phylogenomics and Comparative Genomics, Jiangsu Normal University, Xuzhou, China, 3 Department
of Biology, East Carolina University, Greenville, NC, United States, 4 Xuzhou Institute of Agricultural Sciences in Xuhuai
District, Jiangsu Xuzhou Sweetpotato Research Center, Sweet Potato Research Institute, CAAS, Xuzhou, China, 5 Key
Laboratory of Biology and Genetic Improvement of Sweetpotato, Ministry of Agriculture, Xuzhou, China
Sweetpotato (Ipomoea batatas (L.) Lam.) is an important industrial and food crop.
Edited by: Both chilling and heat stress inhibits sweetpotato growth and development and then
Angeles Calatayud, affects yield. However, the physiological and molecular mechanisms of sweetpotato
Instituto Valenciano response to chilling and heat stress is unclear. In this study, we investigated the effect of
de Investigaciones Agrarias, Spain
extreme temperature on sweetpotato physiological response, with a focus on oxidative
Reviewed by:
Sang-Soo Kwak, stress and the potential microRNA (miRNA)-mediated molecular mechanism. Our results
Korea Research Institute showed that both chilling and heat stress resulted in accumulation of reactive oxygen
of Bioscience and Biotechnology
(KRIBB), South Korea species (ROS), including H2O2 and O
?
2 , and caused oxidative stress in sweetpotato.
Qingchang Liu, This further affected the activities of oxidative stress-related enzymes and products,
China Agricultural University, China including SOD, POD, and MDA. Both chilling and heat stress inhibited POD activities but
*Correspondence: induced the enzyme activities of SOD and MDA. This suggests that sweetpotato cells
Zongyun Li
zongyunli@jsnu.edu.cn initiated its own defense mechanism to handle extreme temperature-caused oxidative
Baohong Zhang damage. Oxidative damage and repair are one mechanism that sweetpotato plants
zhangb@ecu.edu
respond to extreme temperatures. Another potential mechanism is miRNA-mediated
Specialty section: gene response. Chilling and heat stress altered the expression of stress-responsive
This article was submitted to miRNAs in sweetpotato seedlings. These miRNAs regulate sweetpotato response to
Crop and Product Physiology,
a section of the journal extreme stress through targeting individual protein-coding genes.
Frontiers in Plant Science
Keywords: sweetpotato, chilling, heat stress, miRNA, oxidative stress
Received: 26 January 2020
Accepted: 30 April 2020
Published: 26 May 2020 INTRODUCTION
Citation:
Yu J, Su D, Yang D, Dong T, Both chilling and heat stresses dysregulate active oxygen metabolism in plants, which leads to many
Tang Z, Li H, Han Y, Li Z and Zhang B cellular and physical changes, including oxidative stress, cell membrane lipid peroxidation, protein
(2020) Chilling and Heat denaturation and nucleotide damage; the damage caused by the stress may also cause cell death
Stress-Induced Physiological (Kuk et al., 2003). To avoid the damage caused by oxidative stress, during the long history of
Changes and MicroRNA-Related
Mechanism in Sweetpotato (Ipomoea evolution, plants develop their own antioxidant system to regulate the levels of reactive oxygen
batatas L.). Front. Plant Sci. 11:687. species (ROS). With increase of heat stress, the plasma membrane permeability was increased in
doi: 10.3389/fpls.2020.00687 the leaves of four Lysimachia plants, and the activities of SOD and POD were first increased and
Frontiers in Plant Science | www.frontiersin.org 1 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 2
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
then decreased, while the contents of chlorophyll, soluble protein, participated in heat stress by regulating the expression of
and proline were decreased (Xu and Zhang, 2009). The study L-ascorbate oxidase (Jeong et al., 2012). Xie et al. (2017) identified
performed by Ren et al. (2012) showed that after treatment 190 conserved miRNAs and 191 novel miRNAs associated with
with heat stress for 24 h, the SOD activity was significantly chilling stress in sweetpotato. Although certain stress-responsive
higher in treatment groups than that in the leaves of controls; miRNAs are highly conserved among different plant species,
however, POD activities were lower than that in the controls. Li there are also some species-specific miRNAs such as miR403
et al. (2015) observed that SOD, POD, catalase (CAT) activity that respond to chilling stress only in a specific plant species
and malondialdehyde (MDA) content were increased in the (Zeng et al., 2010).
leaves of Atractylodes lancea with the prolongation of heat Sweetpotato (Ipomoea batatas (L.) Lam.) is an important
stress. Under chilling stress, the activities of CAT, POD and industrial and food crop, and it is widely planted around the
SOD and MDA content were increased in potato leaves; at world. However, sweetpotato is very sensitive to temperature
the same time, chilling stress also increased the contents of change. Both heat and chilling temperature potentially affects
soluble sugar, protein, and proline (Xu et al., 2016). However, as sweetpotato growth and development and further affect
increasing the chilling treated time, the changes in physiological sweetpotato yield and biomass. Although there are several reports
indicators showed different trends. Wang et al. (2010) observed on impact of extreme temperatures on sweetpotato (Kim et al.,
that chilling treatment affected membrane lipid peroxidation and 2011; Fan et al., 2012; Ji et al., 2017a, 2019, 2020; Xie et al., 2017,
antioxidant enzyme activities in Capsicum annuum seedlings. 2019; Wang et al., 2019), but these studies majorly focused on
There are also several studies on the impact of temperature gene expression analysis and the impact during the sweetpotato
stress on sweetpotato gene expression. These studies show that storage. There is few study on the impact of temperature stress
low temperature treatment induced aberrant expression of many on sweetpotato seedlings, particularly on the oxidative stress.
coded and non-coded genes (Ji et al., 2017a, 2019, 2020; Xie et al., Additionally, the physiological and molecular mechanisms
2017, 2019). Several studies over-expressed an individual gene to for the chilling and heat-induced damages are unclear in
enhance the tolerance to low temperature stress in sweetpotato sweetpotato. In this study, we investigated the physiological
(Kim et al., 2011; Fan et al., 2012; Ji et al., 2017b; Jin et al., 2017). changes, particularly oxidative stress, in sweetpotato seedlings
Wang et al. (2019) also recently studied the antioxidative system during chilling and heat stress; then, we studied the expression
in sweetpotato root under low temperature storage condition; profiles of selected miRNAs and their targets to elucidate the
their result showed that the activities of antioxidant enzymes were potential miRNA-mediated mechanism during sweetpotato
changed quickly during sweetpotato storage under chilling stress response to these two aberrant temperature treatments. Our
(Wang et al., 2019). results provide an important scientific foundation for breeding
MicroRNAs (miRNAs) are an abundant class of endogenous high tolerant sweetpotato to heat and chilling stress as well as
non-coding small regulated RNAs that play a critical role in gene better storage of sweetpotato and better agricultural practices for
regulatory networks at the post-transcription levels (Zhang B. sweetpotato cultivation.
et al., 2007). miRNAs are widely existed and highly conserved
in plants. miRNAs regulate plant growth and stress tolerance by
complementing the mRNA sequence of a target gene, mediating MATERIALS AND METHODS
the RNA-indcued silencing complex (RISC) to degrade the
mRNA of a target gene or inhibit its translation (Li and Zhang, Sweetpotato Culture and Temperature
2016). In recent years, with the rapid development of sequencing Treatments
technology, molecular biology and bioinformatics, research on Sweetpotato [Ipomoea batatas (L.) Lam.] cv. Covington was
small non-coding RNA has become a research hotspot (Zhang grown and maintained in the greenhouse, which is bred by North
and Unver, 2018). miRNAs not only participate in the regulation Carolina State University and are currently widely cultivated in
of plant growth and development, but also in plant response to the United States. The seedlings at same age and size (about 6 cm
various abiotic stresses, including chilling, salinity, heat, drought, in height) were selected, cut and re-planted in the 7× 7× 7 pots
and oxidative stresses (Zhang, 2015). There are more and more with commercially artificial soil. Traditional practices, including
reports on the regulation of conserved miRNAs for plant stress watering, was performed daily. After 2 weeks of culture in the
adaptation. However, miRNAs are differentially expressed in greenhouse, all the seedlings generated roots and grew well. The
different plant species, tissues, and stress. Under chilling stress, seedlings with similar growth were transferred to the growth
three conserved miRNAs with significant expression changes incubators for temperature treatments. The seedling plants were
and 25 new candidate miRNAs were involved in Brachypodium divided into three groups and they were cultured at 4, 25, and
response to low temperature treatment (Zhang et al., 2009). 47?C, respectively. 4 and 47?C represented chilling and heat
When wheat and barley were subjected to heat stress, several treatment and 25?C served as controls. 4?C were the temperature
miRNAs, including miRl60, miRl66, and miRl67, show aberrant commonly used for the low temperature treatment (Ji et al., 2020;
expression (Xin et al., 2010). In Arabidopsis thaliana, miR156 Vyse et al., 2020). Sweetpotato grows at summer hot season,
responded to heat stress by targeting on SPL transcription factor it may suffer from the 40s?C. To study the impact of extreme
(Stief et al., 2014). The expression of miR397a and miR171 was hot temperature, we treated sweetpotato seedlings using 47?C.
induced by heat stress in the leaves and roots of A. thaliana Each group had a total of 60 plants. To study the potential
(Mahale et al., 2014), and it has been demonstrated that miR397 impact of extreme temperature, after 6, 12, 24, and 48 h of
Frontiers in Plant Science | www.frontiersin.org 2 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 3
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
TABLE 1 | Twenty six selected miRNAs and the primers *.
miRNA miRNA sequence RT primer Forward primer
IbmiR156 TGACAGAAGAGAGTGAGCAC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTGACAGAAGAGAGTG
TATTCGCACTGGATACGACGTGCTC
IbmiR159 TTTGGATTGAAGGGAGCTCTA GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTTGGATTGAAGGGAG
TATTCGCACTGGATACGACTAGAGC
IbmiR160 TGCCTGGCTCCCTGTATGCCA GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTGCCTGGCTCCCTG
TATTCGCACTGGATACGACTGGCAT
IbmiR162 TCGATAAACCTCTGCATCCAG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCGATAAACCTCTGC
TATTCGCACTGGATACGACCTGGAT
IbmiR164 TGGAGAAGCAGGGCACGTGCA GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTGGAGAAGCAGGGCAC
TATTCGCACTGGATACGACTGCACG
IbmiR165 GGAATGTTGTCTGGATCGAGG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCGGACCAGGCTTCATC
TATTCGCACTGGATACGACCCTCGA
IbmiR166 GGACTGTTGTCTGGCTCGAGG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCGGACCAGGCTTC
TATTCGCACTGGATACGACGGGGAA
IbmiR167 TGAAGCTGCCAGCATGATCTA GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTGAAGCTGCCAGCATG
TATTCGCACTGGATACGACTAGATC
IbmiR169 CAGCCAAGGATGACTTGCCGA GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGCAGCCAAGGATGACTTG
TATTCGCACTGGATACGACTCGGCA
IbmiR172 AGAATCTTGATGATGCTGCAT GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGAGAATCTTGATGATG
TATTCGCACTGGATACGACATGCAG
IbmiR2119 TCAAAGGGAGTTGTAGGGGAA GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCAAAGGGAGTTGTAG
TATTCGCACTGGATACGACTTCCCC
IbmiR319 TTGGACTGAAGGGAGCTCCCT GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTGGACTGAAGGGAG
TATTCGCACTGGATACGACAGGGAG
IbmiR390 AAGCTCAGGAGGGATAGCGCC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGAAGCTCAGGAGGGATAG
TATTCGCACTGGATACGACGGCGCT
IbmiR395 CTGAAGTGTTTGGGGGAACTC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGCTGAAGTGTTTGGGG
TATTCGCACTGGATACGACGAGTTC
IbmiR397 TCATTGAGTGCAGCGTTGATG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCATTGAGTGCAGCG
TATTCGCACTGGATACGACCATCAA
IbmiR398 TGTGTTCTCAGGTCACCCCTT GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTGTGTTCTCAGGTCAC
TATTCGCACTGGATACGACAAGGGG
IbmiR403 TTAGATTCACGCACAAACTCG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTAGATTCACGCAC
TATTCGCACTGGATACGACCGAGTT
IbmiR408 ATGCACTGCCTCTTCCCTGGC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGATGCACTGCCTCTTC
TATTCGCACTGGATACGACGCCAGG
IbmiR827 TTAGATGACCATCAACAAACT GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTAGATGACCATCAAC
TATTCGCACTGGATACGACAGTTTG
IbmiR847 TCACTCCTCTTCTTCTTGATG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCACTCCTCTTCTTC
TATTCGCACTGGATACGACCATCAA
IbmiR857 TTTTGTATGTTGAAGGTGTAT GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTTTGTATGTTGAAG
TATTCGCACTGGATACGACATACAC
IbmiR858 TTTCGTTGTCTGTTCGACCTT GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTTCGTTGTCTGTTC
TATTCGCACTGGATACGACAAGGTC
IbmiR171 TGATTGAGCCGCGCCAATATC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTGATTGAGCCGCGCC
TATTCGCACTGGATACGACGATATT
IbmiR396 TTCCACAGCTTTCTTGAACTG GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTTCCACAGCTTTCTTG
TATTCGCACTGGATACGACCAGTTC
IbmiR862 TCCAATAGGTCGAGCATGTGC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCCAATAGGTCGAGC
TATTCGCACTGGATACGACGCACAT
IbmiR393 TCCAAAGGGATCGCATTGATCC GTCGTATCCAGTGCAGGGTCCGAGG GCGGCGGTCCAAAGGGATCGC
TATTCGCACTGGATACGACGGATCA
The reverse primer is same: ATCCAGTGCAGGGTCCGAGG.
Frontiers in Plant Science | www.frontiersin.org 3 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 4
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
treatment, the first fully expanded leaves were collected from Peroxidase activity assay was performed according to a
each treatment. For physiological and biochemical analysis, five previous report (Hammerschmidt et al., 1982). Briefly, the crude
biological replicates were collected for each treatment at each extract was used to react with a solution mixture, including 0.2 M
time point. For gene expression analysis, at least three biological sodium phosphate buffer (pH 6.0), 0.3% guaiacol and hydrogen
replicates were collected, and the samples were immediately peroxide (H2O2). The oxidation of guaiacol was monitored
frozen at liquid nitrogen and then stored at?80?C. by the increase in absorbance at 470 nm for 1 min with a
spectrophotometer.
?
Physiological and Biochemical Analysis The atomic oxide radical anion (O2 •) content assay wasmeasured according the method of a previous report (Wang
Analysis of H2O2 Accumulation and Luo, 1990). The supernatant was added to a solution
The analysis of H2O2 accumulation was carried out using a containing 50 mM sodium phosphate buffer and 10 mM
3,3?-diaminobenzidine (DAB) staining method according to a hydroxylamine hydrochloride. The reaction was performed at
previous report (Thordal-Christensen et al., 1997). Briefly, plant 25?C for 30 min. Then, 17 mM sulfanilic acid 1 mL and 17 mM
leaves were individually immersed in 1 mg/ml DAB solution (PH 1-naphthylamine solution 1 mL were added into the reaction and
3.8), and then incubated in an incubator at 28?C for 8 h. After mixed thoroughly; continuously kept the reaction at 25?C for
removing the staining solution, 95% ethanol was added for 24 h another 20 min. The absorbance was measured at 530 nm with
to remove chlorophyll. The brown spots on the leaves present the a UV spectrophotometer.
accumulation of H2O2. The more brown color represented the Malondialdehyde (MDA) analysis was performed according to
more H2O2 accumulation. Five biological replicates were run for previous studies (Heath and Packer, 1968; López-Serrano et al.,
each treatment and control. 2019). Briefly, one gram of fresh leaves was ground in 10 mL of 5%
trichloroacetic acid buffer mixed with quartz sand. Homogenates
Enzyme Extraction and Analysis were centrifuged at 3,000 rpm for 15 min. 0.5% TBA was added
One gram of fresh leaves was homogenized on ice in 5 mL of to the extract, and the mixture was heated at 100?C for 15 min
50 mM sodium phosphate buffer (pH 7.8). The homogenate was and then quickly transferred to an ice bath to block the reaction.
centrifuged at 10,000 rpm for 20 min at 4?C. The supernatants The cooled mixture was centrifuged at 3,000 g for 10 min. The
were used for analyzing superoxide dismutase (SOD) and absorbance of the supernatant was recorded at 532 nm and
peroxidase (POD) enzyme activity and the atomic oxide radical 600 nm with a UV spectrophotometer.
anion (O ?2 •) content. Five biological replicates were run for each
treatment and control. RNA Isolation and Gene Expression Analysis
Superoxide dismutase activity assay was performed according Total RNAs were isolated from the leaves of each treatment and
to a previous report (He et al., 2009). Briefly, the crude extract control at each time point using the mirPremier©R microRNA
was added to the reaction mixture including 50 mM sodium Isolation Kit (Sigma) following the supplier’s instructions. The
phosphate buffer (pH 7.8), 0.75 mM nitroblue tetrazolium purified 1000 ng RNA was reverse-transcribed to cDNA using
(NBT), 26 mM methionine, 0.02 mM riboflavin, and 1 µM the TaqMan©R MicroRNA Reverse Transcription Kit (Applied
ethylenediaminetetraacetic acid (EDTA). The enzyme unit is to Biosystems). Quantitative real-time PCR was employed to
inhibit 50% of NBT photochemical reduction. analyze the expression of 26 miRNA and their 14 targets by using
TABLE 2 | Fourteen miRNA target gene, one reference gene and their primers.
Gene name Gene ID Forward primer Reversed primer
Ibelf* XM_019343175.1 CCATCTCTTTGACGGCTGGTTG TCTCTGCACGCTCAAGAAGG
IbAP2 >comp100367_c2 TGGGATGAAGGGTGCTGTTC ATTCGACACCGATCCAACCC
IbARF10 itf10g17680 GTCACGACCAGCGTTCTTCA GGCTGAAAGGGATTGCTTCG
IbARF8 itf08g06430 AGTCGGCTCCTAAGTCCTCC TCGAACCGCTAGGTTTGTCC
IbATHB >comp1489_c1 AGCTGGCCTTCTCGCAATAG AATCCGGACCAGGCTTCATC
IbCNR8 >comp78842_c1 ACGAAACGAGAACCAGGGAG TGTGTATTGGGAGGTGTGGC
IbDCL1 >comp62741_c1 GACATTCTCCAGGGTGGGTG TCATTGCCAAACAGCACAGC
IbMYB itf15g01410 TGCGTAATAGCCAGATGGGC TCCTCCTTGAAGTCCAGTGC
IbKPNB >comp25211_c2 GTGGCCATTGCCTCAAACTG CACTGGGCAGTAATGCTGGT
IbMAA >comp102512_c2 TTTCAGCGAGCAAATGTGGC ATCAAAGTCGCACCATTGCC
IbNFYA >comp27679_c3 AGCTATGGAAGCCGATGCTG GCACCCGAGATCCATACACG
IbSPL15 >comp20044_c1 ATGGATTTCGCCTCGTACCC TAGCAGCATCCGAACCTAGC
IbSPL2 >comp104349_c6 TGGGATGAAGGGTGCTGTTC ATTCGACACCGATCCAACCC
IbTCP2 itf02g19880 CCTAGTCAGCAACTCGGCTC CCCGCAAACATGCCTAACTG
IbZAT >comp93639_c2 TTCTTCACCACAGGAACGCC TGGAGTTCGCCATTGGACAG
* reference gene.
Frontiers in Plant Science | www.frontiersin.org 4 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 5
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
SensiFAST©R SYBR HI-ROX Kit (Bioline) on a 7300 Real Time plant growth and development. However, no study has shown
PCR System (Applied Biosystems). how these miRNAs response to chilling and heat stresses in
To explore the regulatory role of miRNAs and their target sweetpotato seedlings. A total of 14 miRNA target genes were
genes in sweetpotato response to chilling and high temperature also analyzed and their corresponding miRNA were IbMAA
stress, we analyzed the expression profiles of 26 miRNAs and 14 (IbmiR403), IbAP2 (IbmiR172), IbARF10 (IbmiR160), IbARF8
target genes. The 26 miRNAs were IbmiR156, IbmiR160, (IbmiR167), IbATHB (IbmiR166), IbCNR8 (IbmiR156), IbDCL1
IbmiR164, IbmiR166, IbmiR172, IbmiR390, IbmiR395, (IbmiR162), IbMYB (IbmiR159), IbKPNB (IbmiR166), IbNFYA
IbmiR397, IbmiR857, IbmiR171, IbmiR159, IbmiR162, (IbmiR169), IbSPL15 (IbmiR156), IbSPL2 (IbmiR156), IbTCP2
IbmiR165, IbmiR167, IbmiR169, IbmiR2119, IbmiR319, (IbmiR159, IbmiR319), IbZAT (IbmiR403), respectively. Both
IbmiR398, IbmiR403, IbmiR408, IbmiR827, IbmiR847, gene information and the primer sequences were list in Table 1
IbmiR858, IbmiR396, IbmiR862, and IbmiR393. These miRNAs for miRNAs and Table 2 for protein-coding gene, respectively.
were selected based on our previous studies (Xie et al., 2017) The following temperature program was used: 95?C for 10 min,
and other studies in other plant species (Zhang, 2015), these followed by the 40 amplification cycles at 95?C for 15 s and 60?C
miRNAs were classified to: (1) miRNAs are associated with plant for 60 s. Sweetpotato elf gene was used as a reference gene. Each
response to different environmental stresses, including chilling treatment or control had three biological replicates with three
and high temperature stress, and (2) miRNAs are associated with technological replicates.
FIGURE 2 | Effects of cold and heat stress on H2O2 synthesis in leaves after
FIGURE 1 | Effects of cold and heat stress on plant phenotype after 48 h of 48 h of cold and heat treatment. (a) Control group. (b) 4?C cold treatment for
cold and heat treatment. (a) Control group. (b) 4?C cold stress group. 24 h. (c) 4?C cold treatment for 48 h. (d) 47?C heat treatment for 24 h.
(c) 47?C heat stress group. Compared to the high temperature stress, (e) 47?C heat treatment for 48 h. The results are based on DAB staining as
sweetpotato is more sensitive to the chilling stress. described in the “Materials and Methods” section.
Frontiers in Plant Science | www.frontiersin.org 5 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 6
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
Statistical Analysis curl slightly (Figure 1). Sweetpotato plants were more sensitive
Each treatment and control had at least three biological replicates to chilling stress than high temperature heat stress.
for each measured trait at each time point. ANOVA was
performed to analyze the significance between different treatment Chilling and Heat Stress-Induced
and controls at each time point. If p-value was less than 0.01, Oxidative Stress and the Related
it was considered extremely significant difference and used ?? Biochemical Changes in Sweetpotato
to show the extreme significance. If p-value was less than 0.05, In this study, we found both chilling and high temperature
it was considered significant difference and used ? to show treatment resulted in H2O2 accumulation in sweetpotato leaves,
the significance. evidenced by the leaves change color from green to brown and
there are many brown spots on leaves. This phenomenon became
worse as increasing treatment time. Compared with the control
RESULTS group, there were dense brown spots on the leaves after 24 h
of heat stress. After 48 h of stress, there were obvious brown
Effect of Chilling and Heat Treatment on patches in the mesophyll area, indicating that the content of
Sweetpotato Growth H2O2 increased under heat stress. Similarly, compared with the
Compared with the control group, the treated sweetpotato control group, there was a diffuse brown color on the leaves at
seedlings showed obvious wilting after 48 h of chilling treatment, 24 h after chilling stress, and more brown dispersion after 48 h,
and the leaves of the heat-treated seedlings turned brown and indicating that chilling caused an increase in H2O2 concentration
FIGURE 3 | Effects of cold and heat stress on physiological indexes in sweetpotato leaves after cold and heat treatment. (A) SOD activities. (B) POD activities.
(C) MDA contents. (D) O –2 contents. Five biological replicates were run for each treatment and control. Each treatment and control had five biological replicates for
each measured trait at each time points. ANOVA was performed to analyze the significance between different treatment and controls at each time point. * presents
significant difference between the treatment and the control with p < 0.05. ** presents extremely significant difference between the treatment and the control with
p < 0.01.
Frontiers in Plant Science | www.frontiersin.org 6 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 7
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
in the leaves (Figure 2). It seems the H2O2 accumulation varied resulted in MDA accumulation and reached to the highest at 12 h
between chilling and heat treatment. For heat treatment, the and then it was significantly reduced (Figure 3C). This suggests
H2O2 accumulation is worse in the edge of leaves than that in that high temperature quickly caused plant cell membrane lipid
the middle of the leaves. For chilling stress, it seems that H2O2 peroxidation; however, the chilling stress is a slow process. This
accumulation started from the middle of leaves and then spread result agrees with the results of ROS accumulation in which
out the entire leaves. high temperature produced more ROS and leaves damaged
As treatment going, the SOD activity of both chilling and heat more (Figure 2).
treatment was increased first and then decreased (Figure 3A). It has similar pattern for both chilling and high temperature
At 24 h of chilling treatment, SOD activity reached the top and stresses for inducing O ?2 production (Figure 3D). Both chilling
was extreme significantly higher than that in other times. For and high temperature treatment promoted sweetpotato cells to
high temperature treatment, between 12 and 24 h, SOD activity generate O ?2 ROS at all observed time points. It also clearly saw
reached the highest and was extreme significantly higher than that O ?2 generation was very quickly and soon it reached the
that in 0 and 48 h of treatments. No matter for chilling treatment highest at 12 h of treatment; after that, at 24 h of treatment, O ?2
or high temperature treatment, after 48 h, SOD activity returned content was decreased and then increased again at 48 h. This may
the levels of start points. be the physiological response of sweetpotato to chilling and high
No matter in chilling stress or high temperature stress, POD temperature stresses.
activities were inhibited (Figure 3B). POD activity was continued
to decrease after 12 h of chilling treatment; however, it seems that
POD activity was recovered at 48 h. POD activity reached to the Expression Profiles of Selected MiRNA
bottom at 12 h of high temperature treatment, and then slowly and Their Target Genes Under Normal
increased; however, it did not reach the level of controls. Condition in Sweetpotato
During the chilling treatment, as increasing treatment time, All 26 tested miRNAs were expressed in sweetpotato leaves
leaves accumulated more MDA, but it did not reach a significant (Figure 4). However, their expression levels were different
level (Figure 3C). However, high temperature treatment quickly with a big range. Compared with the reference gene, the
FIGURE 4 | Expression profiles of 26 conserved miRNAs in leaves of sweetpotato under normal condition after 48 h of treatment. Relative gene expression level
represented the relative expression of an individual miRNA gene compared with the reference gene elf. Five biological replicates and three technical replicates were
run for each treatment and control.
Frontiers in Plant Science | www.frontiersin.org 7 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 8
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
range from lower expression by 4.12 10?6× folds to higher lower in the treatment groups than that in the control group;
expression by 2.56 × 105 folds. Among these 26 miRNAs, 13 miRNAs (IbmiR156, IbmiR160, IbmiR164, IbmiR165,
the expression levels of 10 miRNAs (IbmiR156, IbmiR160, IbmiR166, IbmiR167, IbmiR2119, IbmiR397, IbmiR398,
IbmiR164, IbmiR166, IbmiR172, IbmiR390, IbmiR395, IbmiR403, IbmiR408, IbmiR847, IbmiR393) were expressed
IbmiR397, IbmiR857, IbmiR171) were higher than that of extremely significantly lower than that in the control group.
the reference gene; the rest 16 miRNAs (IbmiR159, IbmiR162, After 48 h of chilling treatment, the expression of miR395 was
IbmiR165, IbmiR167, IbmiR169, IbmiR2119, IbmiR319, significantly higher than that in the un-treated sweetpotato
IbmiR398, IbmiR403, IbmiR408, IbmiR827, IbmiR847, leaves, the expression levels of 3 miRNAs (miR397, miR858,
IbmiR858, IbmiR396, IbmiR862, IbmiR393) were expressed and miR171) were extreme significantly higher than that in
lower than that of reference gene (Figure 4). The five miRNAs the un-treated sweetpotato leaves; four miRNAs (miR164,
with highest expression levels were IbmiR160, IbmiR171, miR166, miR167, and miR847) were expressed significantly
IbmiR164, IbmiR397, and IbmiR172. The 5 miRNAs with lower than that in the un-treated sweetpotato leaves whereas 17
lowest expression levels were IbmiR393, IbmiR862, IbmiR169, miRNAs (IbmiR156, IbmiR159, IbmiR160, IbmiR162, IbmiR165,
IbmiR827, and IbmiR167. IbmiR169, IbmiR172, IbmiR2119, IbmiR319, IbmiR390,
All 14 tested target genes were also expressed. Among them, IbmiR398, IbmiR403, IbmiR408, IbmiR827, IbmiR396,
IbMAA was highly expressed whereas the other 13 (IbAP2, IbmiR862, IbmiR393) were expressed highly significantly
IbARF10, IbARF8, IbATHB, IbCNR8, IbDCL1, IbMYB, IbKPNB, lower than that in the un-treated sweetpotato leaves.
IbNFYA, IbSPL15, IbSPL2, IbTCP2, IbZAT) were expressed lower High temperature stress also significantly altered the
than the average (Figure 5). expression of 26 tested miRNAs (Figure 6). After 6 h of high
temperature treatment, two miRNAs (miR162 and miR408)
were expressed significantly higher than that in the un-treated
Chilling and Heat Stresses Altered the sweetpotato leaves, the expression levels of three miRNAs
Expression of MiRNAs and Their Targets (miR159, miR395 and miR393) were extreme significantly
Chilling stress significantly altered the expression of 26 tested higher than that in the un-treated sweetpotato leaves. miR160
miRNAs (Figure 6). After 6 h of chilling treatment, the was expressed significantly lower than that in the un-treated
expression of seven miRNAs (IbmiR159, IbmiR162, IbmiR169, sweetpotato leaves. After 48 h of high temperature treatment,
IbmiR172, IbmiR319, IbmiR858, IbmiR171) was significantly among the 26 tested miRNAs, miR858 was expressed significantly
FIGURE 5 | Expression profiles of 14 target genes in leaves of sweetpotato under normal condition after 48 h of treatment. Relative gene expression level
represented the relative expression of an individual miRNA gene compared with the reference gene elf. Five biological replicates and three technical replicates were
run for each treatment and control.
Frontiers in Plant Science | www.frontiersin.org 8 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 9
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
FIGURE 6 | Chilling and heat stress induced the aberrant expression of miRNAs in sweetpotato leaves. Leaves were collected after 6 and 48 h of treatment. Five
biological replicates and three technical replicates were run for each treatment and control. ANOVA was performed to analyze the significance between different
treatment and controls at each time point. *Presents significant difference between the treatment and the control with p < 0.05. **Presents extremely significant
difference between the treatment and the control with p < 0.01.
higher than that in the un-treated sweetpotato leaves, the were extreme significantly higher than that in the un-treated
expression of two miRNAs (miR397 and miR171) were extreme sweetpotato leaves.
significantly higher than that in the un-treated sweetpotato After 6 h of high temperature treatment, the expression levels
leaves; three miRNAs (miR156, miR167, and miR403) were of IbARF10 and IbSPL2 were significantly higher than that in
significantly lower than that in the un-treated sweetpotato the un-treated sweetpotato leaves whereas IbDCL1 was expressed
leaves, and 18 miRNAs (IbmiR159, IbmiR160, IbmiR162, significantly lower than that in the un-treated sweetpotato leaves.
IbmiR164, IbmiR165, IbmiR166, IbmiR169, IbmiR172, IbAP2, IbCNR8, and IbSPL15 were expressed highly significantly
IbmiR2119, IbmiR319, IbmiR390, IbmiR398, IbmiR408, lower than that in the un-treated sweetpotato leaves. After 48 h
IbmiR827, IbmiR847, IbmiR396, IbmiR862, IbmiR393) were of high temperature treatment, the expression level of IbSPL15
expressed highly significantly lower than that in the un-treated was significantly lower than that in the untreated control groups;
sweetpotato leaves. eight target genes (IbAP2, IbARF10, IbARF8, IbCNR8, IbDCL1,
MicroRNA targets also responded to chilling and high IbSPL2, IbTCP2, and IbZAT) were extremely significantly higher
temperature stress at a different way (Figure 7). After 6 h than that in the un-treated sweetpotato leaves.
of chilling stress, among the 14 tested target genes, IbARF8
and IbSPL2 were expressed significantly higher than that in
the untreated control group, and the expression levels of four MiRNA-Target Shows Reverse
genes (IbMYB, IbMAA, IbTCP2, and IbZAT) were extreme Correlation Under Stress Conditions
significantly higher than that in the un-treated sweetpotato MicroRNAs negatively regulate gene expression by binding
leaves. After 48 h of chilling stress, four genes (IbARF8, IbSPL15, to their target mRNAs for mRNA clavage and/or translation
IbSPL2, and IbZAT) were expressed significantly higher than inhibition. In plant, the majority of miRNAs inhibit gene
that in the un-treated sweetpotato leaves, and the expression expression by mRNA breakdown at the binding sites (Zhang B.
levels of four genes (IbAP2, IbARF10, IbDCL1, and IbMAA) et al., 2007). Thus, the expression of miRNA and their target genes
Frontiers in Plant Science | www.frontiersin.org 9 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 10
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
FIGURE 7 | Chilling and heat stress induced the aberrant expression of miRNA target genes in sweetpotato leaves. Leaves were collected after 6 and 48 h of
treatment. Five biological replicates and three technical replicates were run for each treatment and control. ANOVA was performed to analyze the significance
between different treatment and controls at each time point. *Presents significant difference between the treatment and the control with p < 0.05. **Presents
extremely significant difference between the treatment and the control with p < 0.01.
should be in a reverse manner. It means that if the expression it has been gradually gained people’s attention (Nozzolillo et al.,
of a miRNA gene is increased, the expression of its target gene 1990; Bharti and Khurana, 1997). During cold acclimation, it has
should be decreased. In this study, we analyzed 14 miRNA been observed that cell membrane structure was considerably
targets that are targeted by 10 different miRNAs. Our study show changed (Yoshida and Uemura, 1990; Kubacka-Ze?balska and
that the majority of miRNAs, their expression were negatively Kacperska, 1999). Exposure to hypothermia increased thylakoid
correlated with the expression of their corresponding target genes membrane damage due to ROS production (Leipner et al., 1999;
under both chilling and heat stress conditions (Figures 8, 9); Pastori et al., 2000). As a key enzyme in ROS scavenging system,
however, there were also several miRNA-target pairs show SOD promotes the disproportionation of superoxide into oxygen
positive relationship between the expression of miRNAs and their and H2O2, thus it reduces the peroxidation of membrane lipids,
targets (Figures 8, 9). This suggests that the gene regulation is a maintains the stability of cell membrane, and then removes it
complicated mechanism in the cells, particularly under the stress through different pathways (Bowler et al., 1992; Koca et al., 2006;
condition. Except the miRNA-mediated gene regulation, there Zhang F.-Q. et al., 2007; Zhang et al., 2011). In fact, even under
are also other regulation mechanisms, such as DNA methylation appropriate conditions, ROS is still produced in plant cells, but
and feedback regulation, all of them affect gene expression. For due to the antioxidant system of plants that can clear the ROS
the miRNA-mediated gene regulation, there is also a potential to some extent, so it will not harm the plant cells. However,
that two or more miRNAs regulate the expression of a same under adverse conditions, ROSs are produced in a large quantity,
protein-coding gene. Thus, it is a common phenomenon that the and the activities of various enzymes in the antioxidant system
expression of a miRNA is not always negatively correlated with are inhibited, so ROS can cause damage to plants. SOD and
the expression of its target genes. This is also observed in other POD are two important enzymes in the plant ROS clearance
plant species (Lopez-Gomollon et al., 2012). system. In the early stages of exposure to chilling and heat stress,
plants produce excessive amounts of ROS, and SOD activity is
enhanced rapidly to respond to the stress whereas is not sufficient
DISCUSSION to eliminate excess ROS. After 24 h of stress, the degree of
peroxidation of plant membrane lipids has increased, which is
Chilling and heat (high temperature) stress is one of main factors beyond the self-regulation of plants. Under chilling stress, POD
limiting crop growth, development and then yield and quality; activity remained declining and increased after 24 h. Studies
Frontiers in Plant Science | www.frontiersin.org 10 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 11
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
FIGURE 8 | Position and negative correlations between the expression of miRNAs and their target genes under chilling stress.
have shown that POD has a relatively lagging reaction to low MicroRNAs are an extensive class of small regulatory RNAs,
temperature due to the cross-effect of enzyme activity such as which regulate gene expression at the post-transcriptional levels.
SOD (Zhang X. H. et al., 2015). Zou et al. (2007) and Zhu miRNAs play an important and critical role in gene regulatory
et al. (2007) also observed that POD activity increased under networks. miRNAs are widely existed and highly conserved
chilling stress. Our study is consistent with these results. This in plant kingdom. Plant miRNAs can inhibit gene expression
study show that both chilling and heat stress induced oxidative by directing mRNA cleavage and inhibiting translation of
stress in sweetpotato seedlings. Under heat stress, the decrease target transcripts (McConnell et al., 2001; Rhoades et al., 2002;
of POD activity began to increase after 12 h, but it was still Aukerman, 2003; Mallory et al., 2004; Baker et al., 2005). miRNAs
significantly lower than that in the untreated plants at 48 h of are involved in a variety of biotic and abiotic stresses in plants,
treatment, indicating that under heat stress, POD may not be including pathogen infection, drought, chilling and heat stress
the main protective enzyme in sweetpotato seedlings. H2O2 is (Zhang, 2015). Stress may lead to differential expression of
a common ROS and it is widely existed in plant cells. However, certain miRNAs to regulate plant response to those stresses (He
when it accumulates in plant cells, ROSs cause oxidative damage et al., 2014). To verify the differential expression of miRNAs and
and further affect other important traits. It is well demonstrated their target genes under chilling and heat stress, we can more
that abiotic stress induces the accumulation of ROSs, including deeply understand the regulation mechanism of sweetpotato
H2O2 (Apel and Hirt, 2004). Our study also show the similar after being stressed by ambient temperature. In this study,
phenomenon, as extreme temperature treated, sweetpotato leaves sweetpotato seedlings treated at different temperatures were
generated H2O2. selected as materials, and the expression levels of 26 miRNAs
Frontiers in Plant Science | www.frontiersin.org 11 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 12
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
FIGURE 9 | Position and negative correlations between the expression of miRNAs and their target genes under heat stress.
and 14 target genes were analyzed. Our study found that both targets a protein-coding gene, other factors may also regulate dcl1
chilling and heat stresses induced the altered expression of gene expression.
miRNAs in sweetpotato seedlings, suggesting that miRNAs play MicroRNAs can regulate auxin receptor or response genes
an role during sweetpotato seedling response to temperature to regulate the auxin signaling pathway. Overexpressing the
stress. However, the exact regulatory mechanism of miRNAs miRl67 target genes ARF6 and ARF8 regulated developmental
still need more deep study in the future in sweetpotato. Our abnormalities in A. thaliana and increased the occurrence of
study also show that the majority of miRNAs and their target adventitious roots by regulating auxin signal pathway (Wu et al.,
genes, such as IbmiR156 and its target IbSPLs, IbmiR159 and its 2006; Gutierrez et al., 2012). The ARF transcription factor
target IbMYB, IbmiR160 and its target IbARF10, IbmiR167 and regulates auxin-induced gene expression by binding to auxin in
its target IbARF8, were negatively correlated with temperature response to an activator. This study found that IbmiR160 and
stress, which was consistent with other crops. However, the IbmiR167 acting on ARF transcription factors are up-regulated
expression of miRNAs and their target genes does not always after chilling and heat stress, IbmiR160 and IbmiR167 may
follow a negative correlation. DCL1 is a gene involved in regulate sweetpotato response to chilling and heat stress through
miRNA maturation and function, and it is targeted by miR162. regulating auxin signal pathway.
Therefore, there is also a negative regulatory mechanism between Copper is an essential trace element involved in
miR162 and DCL1. In this experiment, the expression level of photosynthesis, oxidation and other physiological processes.
IbmiR162 and its target gene IbDCL1 is positively correlated After exposure to chilling and heat stress, some miRNAs that
under heat stress. This phenomenon is not surprised because regulate the homeostasis of copper, such as IbmiR398 and
gene regulation is a complicated gene network. Except a miRNA IbmiR397, were differentially expressed. In Arabidopsis, miR398
Frontiers in Plant Science | www.frontiersin.org 12 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 13
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
FIGURE 10 | A proposed regulation network of miRNA response to chilling and heat stress in sweetpotato.
is an important regulator of copper balance, which reduces sweetpotato growth and development by several biological
copper flux to copper/zinc superoxide dismutase and flows processes, including anthocyanin, maturation process, secondary
to more essential biological processes to accommodate low metabolism, defense response, ROS reaction pathway and
copper stress (Abdel-Ghany and Pilon, 2008). In this study, the ABA-dependent pathway (Figure 10).
differential expression of IbmiR398 during chilling and heat
stress suggests that IbmiR398 is involved in sweetpotato response
to chilling and heat stress. Lignin is the main component of DATA AVAILABILITY STATEMENT
plant secondary cell wall, and its degradation is regulated by a
blue copper oxidase-laccase. The two laccase-encoding carrot The raw data supporting the conclusions of this article will be
genes DcLac1 and DcLac2 showed the same expression pattern made available by the authors, without undue reservation, to any
under chilling and heat stress, indicating that laccase can respond qualified researcher.
to chilling and heat stress by affecting the synthesis of lignin
(Kazan, 2015). In this study, IbmiR397, that targets laccase gene,
was differentially expressed during chilling and heat stress. The AUTHOR CONTRIBUTIONS
results showed that sweetpotato IbmiR398 and IbmiR397 can ZL and BZ conceived the experiments. JY, DS, DY, and TD
act on their target genes and caused imbalance of nutrients and conducted the experiments. JY, DY, YH, ZL, and BZ analyzed
metabolites in plant cells. the results. ZL, HL, and BZ contributed to materials and analysis
As a target gene of miR319, transcription factorTCP4 activates tools. JY, DS, ZL, and BZ wrote the manuscript. All authors
the expression of the key gene LOX2 in the jasmonic acid contributed to the manuscript revision, read and approved the
biosynthesis pathway, thereby regulating the signal pathway of submitted version.
the hormone jasmonic acid (Schommer et al., 2008). miRl56
target gene SPL9 inhibits its expression by interacting with
B-type ARR in A. thaliana, thereby blocking the cytokinin FUNDING
signaling pathway and causing its regenerative ability to decrease
(Zhang T. et al., 2015). This work was funded by the National Key R&D Program of
In conclusion, both chilling and heat stresses significantly China (2018YFD1000704 and 2018YFD1000700), the National
induced physiological changes in sweetpotato seedlings, Natural Science Foundation of China (31771367). China
especially on the oxidative stress-related products and Agriculture Research System (CARS-10-B3). The Priority
enzymes; during this biological process, miRNAs may play Academic Program Development of Jiangsu Higher Education
an important role evidenced by the altered changes on the Institutions (PAPD) and 2018 Graduate research innovation
expression of miRNAs and their targets. miRNA and its target project (KYCX18_2128). This work is also partially support by
genes may respond to chilling and heat stress by regulating the National Science Foundation (#1658709) to BZ.
Frontiers in Plant Science | www.frontiersin.org 13 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 14
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
REFERENCES Kim, Y. H., Kim, M. D., Park, S. C., Yang, K. S., Jeong, J. C., Lee, H. S., et al. (2011).
SCOF-1-expressing transgenic sweetpotato plants show enhanced tolerance to
Abdel-Ghany, S. E., and Pilon, M. (2008). MicroRNA-mediated systemic down- low-temperature stress. Plant Physiol. Biochem. 49, 1436–1441. doi: 10.1016/j.
regulation of copper protein expression in response to low copper availability plaphy.2011.09.002
in Arabidopsis. J. Biol. Chem. 283, 15932–15945. doi: 10.1074/jbc.M801406200 Koca, H., Ozdemir, F., and Turkan, I. (2006). Effect of salt stress on
Apel, K., and Hirt, H. (2004). Reactive oxygen species: metabolism, oxidative stress, lipid peroxidation and superoxide dismutase and peroxidase activities of
and signal transduction. Annu. Rev. Plant Biol. 55, 373–399. doi: 10.1146/ Lycopersicon esculentum and L. Pennellii. Biologia Plantarum 50, 745–748.
annurev.arplant.55.031903.141701 doi: 10.1007/s10535-006-0121-2
Aukerman, M. J. (2003). Regulation of flowering time and floral organ identity Kubacka-Ze?balska, M., and Kacperska, A. (1999). Low temperature-induced
by a MicroRNA and its APETALA2-Like target genes. Plant Cell Online 15, modifications of cell wall content and polysaccharide composition in leaves of
2730–2741. doi: 10.1105/tpc.016238 winter oilseed rape (Brassica napus L. Var. Oleifera L.). Plant Sci. 148, 59–67.
Baker, C. C., Sieber, P., Wellmer, F., and Meyerowitz, E. M. (2005). The early doi: 10.1016/S0168-9452(99)00122-3
extra petals1 mutant uncovers a role for MicroRNA miR164c in regulating petal Kuk, Y. I., Shin, J. S., Burgos, N. R., Hwang, T. E., Han, O., Cho, B. H., et al. (2003).
number in Arabidopsis. Curr. Biol. 15, 303–315. doi: 10.1016/j.cub.2005.02.017 Antioxidative enzymes offer protection from chilling damage in rice plants.
Bharti, A. K., and Khurana, J. P. (1997). Mutant of Arabidopsis as tools to Crop Sci. 43:2109. doi: 10.2135/cropsci2003.2109
understand the regulation of phenylpropanoids pathway and UVB protection Leipner, J., Fracheboud, Y., and Stamp, P. (1999). Effect of growing season on
mechanism. Photochem. Photobiol. 65, 765–776. doi: 10.1111/j.1751-1097.1997. the photosynthetic apparatus and leaf antioxidative defenses in two maize
tb01923.x genotypes of different chilling tolerance. Environ. Exp. Bot. 42, 129–139. doi:
Bowler, C., Montagu, M. V., and Inze, D. (1992). Superoxide dismutase and stress 10.1016/S0098-8472(99)00026-X
tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43, 83–116. doi: 10.1146/ Li, C., and Zhang, B. H. (2016). MicroRNAs in control of plant development. J. Cell.
annurev.pp.43.060192.000503 Physiol. 231, 303–313. doi: 10.1002/jcp.25125
Fan, W., Zhang, M., Zhang, H., and Zhang, P. (2012). Improved tolerance to Li, M. Y., Chao, J. G., Gu, W., and Hou, H. R. (2015). Effects of high-
various abiotic stresses in transgenic sweet potato (Ipomoea batatas) expressing temperature stress on photosynthetic characteristics and physiological indexes
spinach betaine aldehyde dehydrogenase. PLoS One 7:e37344. doi: 10.1371/ of Atractylodes lancea (Thunb.) DC. from different producing areas. J. South.
journal.pone.0037344 Agric. 46, 1651–1657. doi: 10.3969/j:issn.2095-1191.2015.09.1651
Gutierrez, L., Mongelard, G., Floková, K., Pa?curar, D. I., Novák, O., Staswick, Lopez-Gomollon, S., Mohorianu, I., Szittya, G., Moulton, V., and Dalmay, T.
P., et al. (2012). Auxin Controls Arabidopsis adventitious root initiation by (2012). Diverse correlation patterns between microRNAs and their targets
regulating jasmonic acid homeostasis. Plant Cell 24, 2515–2527. doi: 10.1105/ during tomato fruit development indicates different modes of microRNA
tpc.112.099119 actions. Planta 236, 1875–1887. doi: 10.1007/s00425-012-1734-7
Hammerschmidt, R., Nuckles, E. M., and Kuc?, J. (1982). Association of López-Serrano, L., Canet-Sanchis, G., Vuletin Selak, G., Penella, C., San Bautista,
enhanced peroxidase activity with induced systemic resistance of cucumber to A., López-Galarza, S., et al. (2019). Pepper rootstock and scion physiological
colletotrichum lagenarium. Physiol. Plant Pathol. 20, 73–76. doi: 10.1016/0048- responses under drought stress. Front. Plant Sci. 10:38. doi: 10.3389/fpls.2019.
4059(82)90025-X 00038
He, Q. L., Zhu, S. J., and Zhang, B. H. (2014). MicroRNA-target gene responses to Mahale, B. M., Fakrudin, B., Ghosh, S., and Krishnaraj, P. U. (2014). LNA
lead-induced stress in cotton (Gossypium hirsutum L.). Funct. Integr. Genomics mediated in situ hybridization of miR171 and miR397a in leaf and ambient
14, 507–515. doi: 10.1007/s10142-014-0378-z root tissues revealed expressional homogeneity in response to shoot heat shock
He, S., Han, Y., Wang, Y., Zhai, H., and Liu, Q. (2009). In vitro selection and in Arabidopsis thaliana. J. Plant Biochem. Biotechnol. 23, 93–103. doi: 10.1007/
identification of sweetpotato (Ipomoea batatas (L.) Lam.) plants tolerant to s13562-013-0191-0
NaCl. Plant Cell Tissue Organ Cult. 96, 69–74. doi: 10.1007/s11240-008-9461-2 Mallory, A. C., Reinhart, B. J., Jones-Rhoades, M. W., Tang, G., Zamore, P. D.,
Heath, R. L., and Packer, L. (1968). Photoperoxidation in isolated chloroplasts. I. Barton, M. K., et al. (2004). MicroRNA control of PHABULOSA in leaf
Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. development: importance of pairing to the microRNA 5’ region. EMBO J. 23,
125, 189–198. doi: 10.1016/0003-9861(68)90523-7 3356–3364. doi: 10.1038/sj.emboj.7600340
Jeong, D. H., Park, S., Zhai, J., Gurazada, S. G. R., De Paoli, E., Meyers, B. C., McConnell, J. R., Emery, J. F., Eshed, Y., Bao, N., and Barton, M. K. (2001). Role of
et al. (2012). Massive analysis of rice small RNAs: mechanistic implications of PHABULOSA and phavoluta in determining radial patterning in shoots. Nature
regulated MicroRNAs and variants for differential target RNA cleavage. Plant 411, 709–713. doi: 10.1038/35079635
Cell 23, 4185–4207. doi: 10.1105/tpc.111.089045 Nozzolillo, C., Isabelle, P., and Das, G. (1990). Seasonal changes in the phenolic
Ji, C. Y., Bian, X., Lee, C. J., Kim, H. S., Kim, S. E., Park, S. C., et al. (2019). constituents of jack pine seedlings (Pinus banksiana) in relation to the purpling
De novo transcriptome sequencing and gene expression profiling of sweet phenomenon. Can. J. Bot. 68, 2010–2017.
potato leaves during low temperature stress and recovery. Gene 700, 23–30. Pastori, G., Foyer, C. H., and Mullineaux, P. (2000). Low temperature-induced
doi: 10.1016/j.gene.2019.02.097 changes in the distribution of H 2 O 2 and antioxidants between the bundle
Ji, C. Y., Chung, W. H., Kim, H. S., Jung, W. Y., Kang, L., Jeong, J. C., et al. (2017a). sheath and mesophyll cells of maize leaves. J. Exp. Bot. 51, 107–113. doi: 10.
Transcriptome profiling of sweetpotato tuberous roots during low temperature 1093/jxb/51.342.107
storage. Plant Physiol. Biochem. 112, 97–108. doi: 10.1016/j.plaphy.2016. Ren, F., Deng, S. H., Lu, C. L., and Yu, W. J. (2012). Physiological responses of rose
12.021 plants to high temperature stress. J. South. Agric. 43, 1664–1667. doi: 10.3969/j:
Ji, C. Y., Jin, R., Xu, Z., Kim, H. S., Lee, C. J., Kang, L., et al. (2017b). Overexpression issn.2095-1191.2012.11.1664
of Arabidopsis P3B increases heat and low temperature stress tolerance in Rhoades, M. W., Reinhart, B. J., Lim, L. P., Burge, C. B., Bartel, B., and Bartel, D. P.
transgenic sweetpotato. BMC Plant Biol. 17:139. doi: 10.1186/s12870-017- (2002). Prediction of plant microRNA targets. Cell 110, 513–520.
1087-2 Schommer, C., Palatnik, J. F., Aggarwal, P., Chételat, A., Cubas, P., Farmer, E. E.,
Ji, C. Y., Kim, H. S., Lee, C. J., Kim, S. E., Lee, H. U., Nam, S. S., et al. (2020). et al. (2008). Control of jasmonate biosynthesis and senescence by miR319
Comparative transcriptome profiling of tuberous roots of two sweetpotato lines targets. PLoS Biol. 6:e230. doi: 10.1371/journal.pbio.0060230
with contrasting low temperature tolerance during storage. Gene 15:144244. Stief, A., Altmann, S., Hoffmann, K., Pant, B. D., Scheible, W. R., and Baurle,
doi: 10.1016/j.gene.2019.144244 I. (2014). Arabidopsis miR156 regulates tolerance to recurring environmental
Jin, R., Kim, B. H., Ji, C. Y., Kim, H. S., Li, H. M., Ma, D. F., et al. (2017). stress through SPL transcription factors. Plant Cell 26, 1792–1807. doi: 10.1105/
Overexpressing IbCBF3 increases low temperature and drought stress tolerance tpc.114.123851
in transgenic sweetpotato. Plant Physiol. Biochem. 118, 45–54. doi: 10.1016/j. Thordal-Christensen, H., Zhang, Z., Wie, Y., and Collinge, D. B. (1997).
plaphy.2017.06.002 Subcellular localization of H2O2 in plants: H2O2 accumulation in papillae and
Kazan, K. (2015). Diverse roles of jasmonates and ethylene in abiotic stress hypersensitive response during the barley-powdery mildew interaction. Plant J.
tolerance. Trends Plant Sci. 20, 219–229. doi: 10.1016/j.tplants.2015.02.001 11, 1187–1194. doi: 10.1046/j.1365-313X.1997.11061187.x
Frontiers in Plant Science | www.frontiersin.org 14 May 2020 | Volume 11 | Article 687
fpls-11-00687 May 22, 2020 Time: 19:45 # 15
Yu et al. Temperature-Induced Physiological Changes in Sweetpotato
Vyse, K., Faivre, L., Romich, M., Pagter, M., Schubert, D., Hincha, D. K., et al. Zhang, B. H., and Unver, T. (2018). A critical and speculative review on microRNA
(2020). Transcriptional and post-transcriptional regulation and transcriptional technology in crop improvement: current challenges and future directions.
memory of chromatin regulators in response to low temperature. Front. Plant Plant Sci. 274, 193–200. doi: 10.1016/j.plantsci.2018.05.031
Sci. 11:39. doi: 10.3389/fpls.2020.00039 Zhang, B., Wang, Q. L., and Pan, X. P. (2007). MicroRNAs and their regulatory
Wang, A. G., and Luo, G. H. (1990). Quantitative relation between the reaction roles in animals and plants. J. Cell. Physiol. 210, 279–289. doi: 10.1002/jcp.
of hydroxylamine and superoxide anion radicals in plants. Plant Physiol. J. 6, 20869
55–57. doi: 10.1021/ja00874a010 Zhang, F.-Q., Wang, Y.-S., Lou, Z.-P., and Dong, J.-D. (2007). Effect of heavy
Wang, H. T., Ai, X. Z., Zheng, N., Jiang, F., and Li, Q. M. (2010). Effects of graft metal stress on antioxidative enzymes and lipid peroxidation in leaves and
on lipid peroxidation and antioxidative enzyme activities of Capsicum annum roots of two mangrove plant seedlings (Kandelia candel and Bruguiera
seedlings under low temperature and weak light intensity. Chinese J. Appl. Ecol. gymnorrhiza). Chemosphere 67, 44–50. doi: 10.1016/j.chemosphere.2006.
21, 1289–1294. doi: 10.3724/SP.J.1142.2010.40491 10.007
Wang, S. Q., Tang, J., Hu, K. D., Huang, Z. Q., Yang, F., Zhang, H. Y., et al. (2019). Zhang, H., Han, B., Wang, T., Chen, S., Li, H., Zhang, Y., et al. (2011). Mechanisms
Antioxidative system in sweet potato root is activated by low-temperature of plant salt response: insights from proteomics. J. Proteome Res. 11, 49–67.
storage. J. Sci. Food Agric. 99, 3824–3833. doi: 10.1002/jsfa.9604 doi: 10.1021/pr200861w
Wu, M. F., Tian, Q., and Reed, J. W. (2006). Arabidopsis microRNA167 controls Zhang, J., Xu, Y., Huan, Q., and Chong, K. (2009). Deep sequencing of
patterns of ARF6 and ARF8 expression, and regulates both female and male Brachypodium small RNAs at the global genome level identifies microRNAs
reproduction. Development 133, 4211–4218. doi: 10.1242/dev.02602 involved in cold stress response. BMC Genomics 10:449. doi: 10.1186/1471-
Xie, Z., Wang, A., Li, H., Yu, J., Jiang, J., Tang, Z., et al. (2017). High throughput 2164-10-449
deep sequencing reveals the important roles of microRNAs during sweetpotato Zhang, T., Lian, H., Tang, H., Dolezal, K., Zhou, C., Yu, S., et al. (2015). An
storage at chilling temperature. Sci. Rep. 7:16578. doi: 10.1038/s41598-017- intrinsic MicroRNA timer regulates progressive decline in shoot regenerative
16871-8 capacity in plants. Plant Cell Online 27, 349–360. doi: 10.1105/tpc.114.1
Xie, Z., Zhou, Z., Li, H., Yu, J., Jiang, J., Tang, Z., et al. (2019). High throughput 35186
sequencing identifies chilling responsive genes in sweetpotato (Ipomoea batatas Zhang, X. H., Feng, L. J., Yang, T. W., Xu, Z. H., and Hu, L. Y. (2015).
Lam.) during storage. Genomics 111, 1006–1017. doi: 10.1016/j.ygeno.2018. Effects of chilling stress on physiological characteristics of rapeseed seedlings
05.014 in winter. Plant Physiol. J. 51, 737–746. doi: 10.13592/j.cnki.ppj.2014.
Xin, M., Wang, Y., Yao, Y., Xie, C., Peng, H., Ni, Z., et al. (2010). Diverse set 0411
of microRNAs are responsive to powdery mildew infection and heat stress in Zhu, H. X., Sun, W. C., Deng, B., Yan, N., Wu, J. Y., Fan, H. L., et al. (2007). Study
wheat (Triticum aestivum L.). BMC Plant Biol. 10:123. doi: 10.1186/1471-2229- on cold hardiness and is physiological and biochemical characteristics of winter
10-123 turnip rape (Brassica campetris). Acta Agric. Boreali Occidentalis Sin. 16, 34–38.
Xu, G. F., and Zhang, Z. Y. (2009). Effect of high-temperature stress on doi: 10.3969/j.issn.1004-1389.2007.04.007
physiological and biochemical indices of four Lysimachia plants. Chinese J. Eco Zou, W., Chen, Y., and Lu, C. (2007). Differences in biochemical responses to cold
Agric. 17, 565–569. stress in two contrasting varieties of rape seed (Brassica napus L.). Forest. Stud.
Xu, J., Zheng, X., Yan, H. F., Tang, X. H., Xiong, J., Wei, M. Z., et al. (2016). China 9, 142–146. doi: 10.1007/s11632-007-0022-2
Physiological responses of different potato varieties to cold stress at seedling
stage. J. South. Agric. 47, 1837–1843. doi: 10.3969/j:issn.2095-1191.2016.11. Conflict of Interest: The authors declare that the research was conducted in the
1837 absence of any commercial or financial relationships that could be construed as a
Yoshida, S., and Uemura, M. (1990). “Responses of the plasma membrane to cold potential conflict of interest.
acclimation and freezing stress,” in Plant PlasmaMembrane, eds C. Larsson, and
I.M. Møller (Berlin: Springer), 293–319. doi: 10.1007/978-1-4939-7411-5_12 Copyright © 2020 Yu, Su, Yang, Dong, Tang, Li, Han, Li and Zhang. This is an
Zeng, C., Wang, W., Zheng, Y., Chen, X., Bo, W., Song, S., et al. open-access article distributed under the terms of the Creative Commons Attribution
(2010). Conservation and divergence of microRNAs and their functions in License (CC BY). The use, distribution or reproduction in other forums is permitted,
Euphorbiaceous plants. Nucleic Acids Res. 38, 981–995. doi: 10.1093/nar/ provided the original author(s) and the copyright owner(s) are credited and that the
gkp1035 original publication in this journal is cited, in accordance with accepted academic
Zhang, B. H. (2015). MicroRNA: a new target for improving plant tolerance to practice. No use, distribution or reproduction is permitted which does not comply
abiotic stress. J. Exp. Bot. 66, 1749–1761. doi: 10.1093/jxb/erv013 with these terms.
Frontiers in Plant Science | www.frontiersin.org 15 May 2020 | Volume 11 | Article 687